Description :
From Genome Similarity Track
Location :
Scaffold_3:500038- 501048
Transcript NameFunction/comments
Sapdi_VS20SDRG_01299hypothetical protein

Sequence
1010 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGCCCGGCGACGCTCTCGAGTACGGAAGCGACGTGGTCGGTGAGCGACCTCCACTACAAGGAGTGCGGCGTCAATGAC
GTCGCGTGCGCCAATGCGTTTTTAGCTCAATCCAACACGATCTGGAGCACGATTGGCCGCGCGTTTGACCAGATTCCGGCGTTCGCTACGTTCACGAACG
GCCATCTCGGCTCGGTGCTCTTGCAAACGGTCCGTGCGATCGATGAGTACCAAGGCGGTATCCTCCAGTTGAGAGCGCCGTGGGACGTCCTTCCAGCGTG
TAGCTGTTTGGGAACTCTGGACGAGTAGATTGAGAACTGAGGTTAGAGGCCAGCGTTGTGAGAGAACGACGGGCTGTGTCGGATGCGATCATCGTCAAGA
GGCTCAATGACGGCGACCGTATACGGTCACTTCCGTACGCCATCCGTACATGGTGCCTAGCACTGTCCAACCTGCACCATACACGCCCATAAATAGAGAC
GTCAGATGCCGACAAAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNN