Description :
From Genome Similarity Track
Location :
Scaffold_21:50000- 75043
Transcript NameFunction/comments
Phyke_g1359hypothetical protein PHYSODRAFT_293759
Phyke_g1360hypothetical protein PHYSODRAFT_321832
Phyke_g1361hypothetical protein PHYSODRAFT_469112
Phyke_g1362hypothetical protein PHYSODRAFT_321830
Phyke_g1363conserved hypothetical protein
Phyke_g1364hypothetical protein
Phyke_g1365hypothetical protein PHYSODRAFT_321827
Phyke_g1366hypothetical protein PHYSODRAFT_309064
Phyke_g1367hypothetical protein PHYSODRAFT_468056
Phyke_g1368hypothetical protein PHYSODRAFT_554409

Sequence
25043 bases(100 bases per row)
GTGGGGCCTTCGACTTGGCGTCAGTTTGACTGCATTGCTGCCAATGATGGATCTTCGTCACAATATCTCTGCTCAAAATGTCAATGTCGATGGGCTAACA
ATGAAATACCAACGCAAAGCCCCTTACTCATTCCCTCCTTCATTGTCAGAGAAGAAGCCACCACGCGATAGTTGATTGTCATCGCGGCTAATATTCTTCT
TGGAAGCTGAATGCAATATCCACACCGTGTGTTGTTTATCAAAGTCTATTGGCGATGATTAGTGCGAGGAATCCTTACTTAAGGCGACGTAACCATCCGT
ATGCGCCGCATCGAAAAAGGAGAACGCTAGGACATAGTCACTCCCATTAGTAAGCGGTAGCATTGGATGCAAATACGCACTGGGGAACATCCTCACTGAA
ATCCGTCTTGTTCTCCGCCATCTtgatgcgctgcagcactggaatAAGATACGACTAGATGACAGCCCCACTCTATTTTGGCACGATGAACTGCCCAGCA
GACGCTTCGACCGGTGGGTGACGAAGCTACCTGCAGGACTCAACTACCTGGTTGGATAAACTACGTCTACATTAGATTACAGGCCGCGGACATCCAGCAC
ACCGCCTTTGAATCGTCCCTTGGTCGCCTGCACACCAAAGTCGACTTTCTTCCGTTTCTGCTGGTCTCTCGACTTGTTGGTGGACTTCCTTTTGCCCGTC
ACCACATCTGCCTCCTTGATCTAAAAGTTgcaaaaaaataaaaaaaaattgcATGACGTGAGAACCACCATCCCTGCCTTCCGCAGCAACTACAAGGCAG
CACACGCACCAGTTCCTCGCGACGCTGTTTCCGAGCGACACCCTTGGTCTTCATGCCGATCAGCATCTTGTACGGCACACTGCGGTTCTTGGCACCTTTC
CCGCCTAAAGcctcgatcttcttggcttcaTGTGCCTTTCTCTCTTTGCCCTTCAGGTTTGAACTGGCTGGTATGAGCAACAAATAGACGCAATTCTGTA
AGTGACGATGGTCTCACTCGGTCCTCATATAGGCAGAATAGCAATACGCACCGAATTCAAGCACAGAGTCGAATGTATCATCAAACTCCTTGCGGATCTC
CTGACGCACTGACAGTTCTGGTGTGTCCTCCTTCGCTTTGTCCTGTTCACAAGTTGAATGTTGTGTCAAAATCATCCCAAGTCAACGTCGTATTGCGAGT
ACAAACAACGAAATTTCGATATGAACCTTGGCAGAATTCGGTTTGCGCTCTTTCCATGACTCAGTAGGGCACTCGAAAACttgcaccttcttcttcttgc
cgctcGCCACTGGGAACTGGAACGCCATCGCGGCTTGGATGCAGCAATAGACCAAGCGAAAAATGACCAACCAAAACGTAACCTTTGCGGGTTACGCAAC
CTACAAAGCCAAACTACAAAATCCTAAACAAATTGACAGGAGGTAGAAATGCACTTAGAAATTGGTTTCTAATTTAGAAACGAATCAGTAGTAACTAGAT
ACAATTAAATCTTACAGTGGTCACACTAGAACTTGGACCTGGAACAGGCCGCTGGCTGCTGGAGGACGCTCGTCACCACTGTGCTCATCAGGCTCTTCCA
AGTCGTCTTCAGTCTCgctttcatcatcgtcatcgccgtATAAGCTGCTGCCGAGGTCTGAACCGAGACTGTCTCGGAAGCTGTCACTGGCCAACTCACT
CATCCATGGATCGACCTTGTCCTCTCTCTTGAATTCGTGCTCAAAGTCGTAGAAGCCACGGCTCTTGATGACTCGACTGCTTCTCAATGGGTTCGCTCGA
CGGCTATTGATGTCCCCTCGCCTACCAGCTGGTGTTGGAGAGGATGTGATGCGTCGTGAGGGtccttgcagctgtggcttGGGGCTCAAGGGAACGAAGA
CACTCTCACCGGCCAATGACTGGTTCAATTGGCTTTCGTCGTGCGCTTGCACTGCTGGGATCGGCCGGTAGCGTGATAGCCGCTGGAAGCGCGGCGAAGG
CTCAGCGTTTATAGGTACCGGGctgggagcagcagctgtaAAATCGGCCATAGACATCGGGCTGGGTGACGgccttcgtcgtccttgagGTGCTGTATGA
AGATGGTCCTCGTTAATTGTCAAATTCCCTAGAGACTGTTGAATCTGGTTCAACCGTGAGAATGCTTGCATTCCGGAGGCATCGTCCAACCGATTCTGAA
TTCCACCGCCACCGCGCATATTATCGCTCTCAAACGCCACGGACTGAACAGGTAACAGTTTCTGCCGAAACGAGATGGCCTGTTGTTGTGCTTGTTGGGT
CTGGAgatctgcttggtgttgctCGTTGAGAGCCCGTTGTGACTCCACAAGACTAGCCATCTTTTCGTTTTCCAGCTGCATCAGCGCTCGCTGGACACGT
AATTCTTCCTTCTCACGCCGTACCTCGTCTCGCTCACGTCGTAACTCCTCACGCTCACGGCGAATTGCTGCTAGCAGCAATCGGTACTCCTCAATGATGT
GactttgctgttgttcctgctgcagctgctgttgttgctgtaaCCGCGATACATTTACCTCGTTATCCTGAGAGTACATTTGCCTCCCCAGCCCGCCACT
CACTGTGCTAGGACCAATCCTATCACgtccatcatcttcattcATCCGCCCATTTCCCTGTGGTATCTGCATTCTTGACGGTGCAGGAGGTGGCATCTGA
ACTCTTGACGGCACAGGGGGCGGCATCAACGTGTCTGCAACAGCTGTACTTCCATAATCTCGTTCCCGATGATAATACGGAGGCATCTCATCAGCTTCTC
GCGTGTCACTATTGGCTCGGAAGCTGCGGCGAAGACTCGTCGACGGCTGGAACGCACCCCTCTGCCCACTTGTCGGCAGCTCTGGAGATGGTATCGACTG
ATACGGCGAATTAATCTCCGCCCGTTGCTCTGTAGACTGAGCCAATGCAGGTGAGAACGGCCCAAGCCGTCTCTGTGctcgtagctgctgctcccgAAGG
TAGCGCATCTCTTCTCTAGCAACGTCAGCTTCACTCCTTCTACGCTCCGCCTCCTGCTTTTCCTTCAACCGCGCCTTCTCCTGCACTTGCTCGTCCAGTA
TCCTCTTCcactgcatctgctgcgcTCGTTCTCGCAATCTCTGACTGGCTTCGCTCTCGTCCGTCACTCGGAAGCGCGGATGGGATGATGAGACGCCGTT
CGCTTCGTCTGTGGGGGCTCCTTGGTCCTGATGCTGCTCAGTAGGAAGATCCATACTTTGTGTGAACCTCCACGGAGCTAGGGACGCTGCGTCTGTATCG
TAATGACCGCCTTCTGCCAGCCATTTGGACGGAGAGTGTTCGCTGGGAGCTAATTTACGCTCAAATTCCTCGCGTTCCAgctgttcctgctgttggCGTG
CACGGCGAAGAGCAATCTGATGATCCAGTTCTCGAGCGTAAGCTTCTCGTCGACGCTGGATCTCTCGTGggtcttcatcaccagcgCCGGTGTCGCTCGC
GGCCCACAGCATCACGGTGCACTTTAGTTTGTTTTCCTGGCAGTTTTTGGGAGGGAAGAAatgtgattggatgaaatgaaTTTAAAGTGGCAGTTGCAAA
ATCATTAAAATAATAAAATCGTTAAAATaataaaaataataaaaACAAATTCGACTAAAAGTTTGGACTGAAGCATGTAATCTCCGCTTTAGAAGGTGAG
CGTATTGCCAAAGAGGCAAGAGTCCGCGTACTCTCGTCGCAAGtccgccaccatcttctccactTGAAGGTCAGTACGTTGACATTCGGATTGCAGAAGT
TGGAAGCGCAATGATACATCGCTCTGGAAGCGCCGCAGTCGTTTGCGTTCCTTCTTGGCTCCATCTTTTGGTCGTCGGttgtgactgctgcttcgacAAC
GATGTTTGCGACTgtgactgcgactgcgactgcgactgcgatCGCTGTCACTGTCACTTTCATTCCCACTGCTCCTTGTTTCACTGTAATTGTCGCCATT
GTCGCTCTCTGgtccacgcagcagcttctgaatGCGCGCTTTCTCGCGTCTACGCCATTTACACTGCTCCAAtgtctccagcagcgctcTGTGCTCGTGT
TGAAGGCTGCGTAGCTGCTCCTGGCCCTGTTGAAgcgcgtcttcttctctgttCAGCCattgcttcttgcgctccacCTCAGCGTACAGCTCCGCCAGTG
TCTTGTGGACATCAGTGTCTTCTATAGTGTTTATCACCTCACTTGGAGGTAATGTCATTAGTTGcttggagctgttgctgctgttgctactgacGCTATT
ACATTCCTCGCTTTTCCCTCGATCATCTAAGAGCTTTTCCTCCATGCGAACACGGAACATTACAGACTTCTCAGTGGTACGCATCACACTACGATGCGGA
ACCGACTCGACCGTTTGGTCTGTCGACCAAGCAGGAGAGGCGCTGGGGCCATGGGGGAGAGcgctggacgacgaagacacGGCGTCCTCGCTCATTCTGG
TTACAAGTTGTTGGCGCAGTGATCCTTTCGATGACTTGAtattttcaaccaatcaaatgaTAAAATTAGATTATGAACCAATCAAAAGCGGTGATATCCG
TTaaacagcaacttcaagtgACATAAAGTGTTGGTTATCTATGCTGTAGGGCAGCGTTCCTCTCTGGAAACTGCACGGTCGTCCAGTATAGCTTGCAGCT
ACTCGTTTGAAGTTTAAACAAGCGCACGATGCGGGACGGGGTTGCTGGTCGGGAGCGGCGAAATCATCGGAGAAAAGATTGGTCGCGAGCTGTGCATCAC
AGCCACAGAGtgcgcaccaccagcagagACCTGACGAACGGGGATCGGGCCGAGGTCCAAACATGTAGGCACCATCAGAGATTTTATATCCGTCAAGCCG
AGTCGCCCGTGGCTACAAACAGTCACATCCACGCGGTTAGCTTCCAGCTTACAAGACGACTGACCCAACTCAATAGGCACGTACTCAGGTCGTCCTGCAA
CGTAGGCGATACCGTCACTGGTGACGAACAAAGTATGAGAGCCTCCACATGCAGCCTGAATCACCGTTTTTCCCTGAAGCGCCTTCACCTATGAAAATAA
CAGCATTTATCTTGTCAGCAACTGGGCTGCTACAGTTGAAAACACTGCGCCATACCAAGTGAGGTCGCGTCCGACTCTTCGTATCACCGAGGCCGAGTCG
GCCATATTCACCCCGCCCAAAGGCGTAGCAATCTCCGGACTTGGCCACCACGACAGTGTGCCAACCACCACACGATACACGCCTGATTAATCCAATATCC
CAAAACTCATTCAGTCATAGGCAACAAAATGTCGATACATCGCCAAGGCATTGACGTACAAGGCTGGGATCGTATCAAAGAACTCGACTCTCTTGGGGGT
TTGCTGGTCGGAGGTTTGGCCAACACCGAGCATGCCATAGTCCTCCTTGCCCCAAATGTACACATGGCCTTCCTCAGTCACAGCAGCCGAGTGGAAGGCA
CCACAAGCTACCTGCACCACTTTTTCGCCGTTGAATCCTTCCAGCAGGTGCGGTCGACTCACTCCAAGAAGACCGTCATCATCGGTATCTTGCAGCCACG
TCGACCCGATACCTAGTTGTCCGCTATCACCACGACCCCAGACGTAGACACGCCCCAAATTCGTCAGAGCAGCCGTGTGTGTCCCGCCACAGCTCACCTT
CAAGATGATTTCTCCACTGCCTTCCTCCAAGATGGGGCACTTGATCGGCAGCAGAACGTGTGCCTTAAGTTTATCGTGTCCAGTAGCCTCGCCAGGCAAC
AACAGGTCTGCTGAATCAAGATACTCCTTGGGAAGTCCCAGTTGCCCCCAGTGCGTCTCACCCCACATATACAGCGAACCTAACATCAAACACACACAAT
TCATCAGTGAATGACCCATACCCACGGAAAACTCAAAGAATAACACACCGTCATTggtcacagcagcagagtgGCAGCCTCCGCACGAAATGTAGTCCAC
AATAAGACTATTTTTCTCAAAGAAGTCAATCTTCAGTGGCTCATTGATGCTCTTATGGTCTCCGTGGCCCAGTTGACCCATCTAGAAGTACACAAAATCA
TAGAAAGGAATGAGCAGGTAAAAGACAGCTACAGCCACATAACCATATACAAAACGCACCGATCCCCAACCCCATGAGTATACACTGCCAGTGGCAGTAA
GCGCCATTGTATGACGTGAACCACACGAGACTGCCACGATCTCCTCGCTAGCCAATGCAGCCAATGTCTGGGGGAAGTTGGAGGCTGACACGTCGTCGAT
AGCCAACATCGCTCGCCGCTTGGCTCCTGTGCCTACCTGTCCATCGTCATTGCAGCCGAAAGCCACCACCGCACACAGTGTTGCCCCCGTTGtcatgctg
ctggaaggaagTGCGTCAGTGAATGCGAAAGCGTGAATGAGAAAGCTGAGACgcaccaccaagcaccatATGCTTCGTAATTTGTGTGGTTTACATCAAA
TGATACAACACTGATTTGGTATTTTGTGCATGTTGAAGACAGCTTCAACTTAAGCCAATCATGTTGATTCGCCTGTTGTGGAGACTGTGTACATTTGAGC
CTTGAGGATGTCGAGTCGTGGACCACGCACTCGTCCGTGCTTGCCTTGAAGTTGGCGCTTTATGTCGGCAAAGCGGACTGCATTCGGGTTTCGAGGTGGT
TTTAAACCACCCCACGGCTTGGACTCGTCAGCCACGACATTGTCGGTGCTTACTGTTTTCGTGTCTCGTACTTCACTTCCAatcctgttgttgctgctag
tCGCCGTCTTTAAAGAGTGCTGAATATGAGAGTGAGTTTCGGGGCCCAAGTCACtttcatcctcttcgtcctcgacAGATTCACCAACGTATTTCATGGC
TGAGCTCCTGCTTGAAAGGGGCAGTTTAACCTGGTGCACCATCATGCGAGTCGTGCGCTTGATCTGGAGCTGATATTTGTATTTAGCCAGCAGTCGTTCG
CGAAAGTCGACCGCCTTCGCCTGTTGCTTCCGGGCTGCCATTTCCCGACGATAGGCCTCTCGTTGGGCTGGGTATTTGATCGTCCCCTGTAGTGCTCGGC
AGAAACGACGACTCTCATGACCACGAAACAAACGCTGGATCTTAACCGCTGGGGACTGCTGAATGCCCTTCAACCACCCTTTTTGTTGCTTGAATTCGCG
GAAGATCATCCGCGTCGTAAGTCCGCGCCACCGCGCCTGTATGCGACTCACCAGAGCATGTTCACGACGTAGAACACGTCGCGTGATCTCCAGCACATTG
TTCTCCACCTTGATGAGTGTCGGTTTGCCACCTGATCGGCGTACATACTCCCGGTAGTTCCAGTAGAAGACGTTAATCTCCGCGGTGTTGGTGTACCAGA
AGACTGGTGGTTCGTTCGGGCGAGCAGCCAGTGCGTACATTAGGATCGGTGGTGCCATGAACCGAATTATCTGCAAGCAGCGCTCAATGACAGTACGTCT
CCAGGCCTGCATCCCTCTCACTCGTGCCTGCAACTTCGTAGCGGCTAGGTTGATTTTTCTAAGGAATCTTTCACGTTCTACTAGACGACGGCGGAACTCA
AGGCGACCGAGAAAACCACGCGCGATACGCTGTATCAGCGCCGTAGCCGGGACTCGTCGCCGTTCAAACTCCTTAATGGCATTCCGCTCTTCCTCAATTT
GTTCCTGGAAACTCACAACACCGGCACGGAGGTATCGTGTGCTTCCGCAGCCTGGGCATTTTGGCACCTGTTCATACAGATTGGTGGTGTCTTCGCTCTC
ACCTGGTAAGTTGGAAGCGAGTTGGTCTTCTTTTTGCCGTACTCGCCGCACGTCAACGAATGCTATACTGTTGCAGCGCTGGCAGGTGAGGTATGGTGTC
ATAACACTGTATAAGTCGTCGTAAGGTGTCTTCATCGTAGCGTCCGGCTTTTGTGTGGCTGCATCCTCGCCATCGCAAGACGTTGAGTCAATGAGGTGAT
GTGTGGCATCGATATCGTGGGATGAAGCCACCGGCAACTTGCTCGACAGTGTATTTGCTTTGCCCGGTGTTTTATTGGACATGGTCTTCCACACAGCTCA
TAGCGTCGGGCCGATTGAACACGGCACCGTTTCGTACGAGGATTCGCAACGCACGAGTAAAGATAACGTGTGTTGCCTTAGCCACGGTATTGTATAGTAC
ACAAGTGGCTTCAAGCGCTACATGCTAGTACCAAGAAAAGTATTATAAAACGATATCGTATTGAAAATGCTCAACGCAAGCAATGCATACACCTGACGAT
TTTCGCTTAATCGTCTTCAGCAATATcttcttccatctcgtcctcgacttcgtcgtcatccgCCGGGCGGCTCAACTTCGCCTCACGCGAGTTTGGACGA
CTCATTGCTGCCTCACGATACGCTGGTCGATCAGCCTCGCGCGAACCTGGGCGGCTGAAATGAGCGTCACGTGAATCTGGACGACCGGACTTAGCCTCAC
GAGAACTTGGGCGACTCGACTGGGCTTCACGGGAGCCTGGACGGACGGAGGGGGGGCTCTCTTTGGCTTCGCTGCGTGTAGGCCTGCCGCGTCGGTCATC
CCCCAAGGACACGCCTAATTTTGCTTGTACAGCCTCAACCACCCGCGGGTCCACGTACGCTTTGAGCGTGAGCCCTTTGCGCCtcatctcctccatggtC
TCGAGGCTCTTGTTCAGGTCACCTTCTTCGTAGTAGGCTTCCGTTAGCATGGCGTACGCATCGCCCACACGAATGGCCTCTTCGATACCAGGTTCCTCTA
ATAATTTGGCGACAATATCCATCATCTCTTTGGGGTTGTGCTTTACCTGTTTCCTTGCCACCACGAACTGCTCGATTAGCAGAATGCGTTTCTCGTAGCG
CTTCAGCAGAGCATCCTTGCCGTCGCCTCGAGACTTGGACACCACCTGCACTGCTTCTTGCAACGCGGAAATTGCCTTCTCATAGTCACGATActcctca
atctccactTGTGCACAGCCGGCGTAAAAGTTCCCAAGCTGCTCAAATGCGCGAGCTTTCGTGTAAAACCCTACGATATTCTTCAAGGTGTCTCCGTCCT
TACGCCAATCGAGGTTCTGCAGGTAGTTGGctgccaagatgaagatttGAGCATTGCGCGATACGTTTGCGAAGAAAACCACCTTCTCAGTGTCGCCCGA
CTTAAGCAAACATTTCATGGCCTTGAGCTTGTCTCCAGCCTGCGTATACTTCTTTGTGGCCAGGTGGTAAGAAccttgctgtttgcagcatTTGGCGAGT
TTGAGAAGCAGCTCTGTACGTCTCTTCTTGTCCGCGGGCGTGGAGCTATCATCTCCCTTGGGTGGTGTCATTTTCTCGGCCATTTCTTCTGTTACTTTCA
CGTCATTTTTCATGCACACATCCAGTGCCTCAGCAACGCGATTTCCAATCAAACACAAGTGCACAGCCTTGGCATATTGCCCGTTTGTGATAAAAAAATC
GGCACATTTCTTCAAGATGGCAGGCGACGTGTTGCCAGAACCACTAAGCTCATCTGTGAGATGGTGCAGCTCCTCAAAGAGCTGCGCCTGAAAGCACAGA
TCCAGTGCCTTAGCCACATTGCCTCCCTTGTGGTAAAGCTGGacagccttctccatctctcgCTGTTCCTCGAAGTACAAAGCACAATCAAGCATATCGC
TAGGTTTGCTCATGAGTGCAAACCCCATGAGGTCGGCATCCATTCGATGCTCCTTAGCTAGGCGTATGGCGTGATTGTAGCAACCGCCACTCGCGAAGAA
GTGTATCGCGTTTGAAATTTCATTGTGTGCTTCAAACTGTCGTGCGAGGTGATACGCTGCCGCGCGATTTCCACTAGTCTGTGCCACCTTCGCTGCCGCC
TGAAAATCTTTCTTAAAACACAGCACGCGCACGATAGACAGATAATCCTTGGCACGCTGGTAGCTGTCTACTGCGGCATCAAACTGGCCTTGGCTCTCTT
GAAATTGTGCCCACCAGATCAGTAAGTCGCGATCGTTCGAAGTTGTCACGTACTTCTGTAGCAAGTCTACCTTGCCCAGTTTGAAAAGCATGCGCGGAAT
ATCTTTCTGGTGGGTACCAGCATCTTCGTATGCCTCCATCGCCTCCTTGAGATCACCAATTTCCTCGTAGTTCCGAGCCAGCGCATGATACGTCGTCTTG
AGATGGATACGATCACGCTTCGACGCAACATCCACCGCTTTCTTCCAGTAACCACTGGCTTGGTAAAGTTTGTTCAAGAGGTCGTATCGTCTGCACTCAC
GGTATAACCGAGCCGCATCGTCACGCAAACCAAGTTGGATCGCAACCATGGCAatcgccacctccagctcGGGCTCCTTTTTTGCTTCTTGGACGGCAGC
GGCTCCGCGTGCATGCCCCATATTCCCAAGGCACACCTCGGCCACATCTAGCCGCTTTGTCTTCACGCACATGCGTGCCATATTCTCCCAAACTGACGGG
TTTTCAATAAGTTTCACCGAACGATACGCCTCATCCATGTTGCCGACCGTCATGAAATAGCAGAAGTCAATGAGAGCTTGTCTCGCCTCATTGTTTACCT
TGTCCAGTCCCGTGAAGTCTCGCATAATCTGTGTGCGCAGATAACTAACAGCATCGTACGCGCTTGGAGATTTTGTCACGACAGCGTTTGATTTATTTCG
ACCAACATGCACCACAGTCGTAGTGGCATCCGAGGAACCATTTTCCACTTTCGCCACAAAGTACACACGCGGAACCTGAATGCCAAGCAACGCGCTGTAT
TTCAGGTCCAAGTCGAAGTTATCTTGCATGAGCAGGCCGTGGTCGTTTGAAGCAAAGATGATGGTGATCTCCTTGTCCGACACTATGTTTCCACGCACAC
CACCCATCCCAGTACCTAAGCCATCATCAGTACCCAAGTCACGCCGACCACCAGCCGCGCCTCCTGTCATCGTCGACATAttgtcgttgctgcttttAGA
GGTTTCGCAAATAAGCAGCCTCGGCTCTTGTGGATCGAAGAAAACTGAGTTCGGGTAGCGCGAGGGGCCAAAGTCGAATTGCTGGTAAATATTGAGATCC
GTCTGGAACAAGTAAAGCTTATTTAGTGGCTCTCGGATTTTTAGCGCACCCTCAACGCGGTCAGCAAGAATGCAGACGCGGGTACCGTCCGCATTTACGC
AGATGGAGCGCATTACGGCGGATTTGGTATCTTCAAAGGCCTCAGGAAGATTGCCCATACTGCCCAGAGCCTTTGGGTCACGACGGGATACATCAAATAC
ACGAAGTAAGCCGCGGTCTGTGCCGACTGCAAGAAACTTGCTCTGTAACGACAGCATCGTTGGCCGACCTTCGGCCTCCGTGAAGGAGATAGAGTTCTTA
ACAACCCCTTGCGTGTTGCAGATCTCAACATGATTTCCATTCGCTCGGTAGATAGATTCACCACGAAGCACCATGGCGCTCGAGAAGCAATTGAAGTGGT
TAACGAGCTTGGCATCGCCATCCTTCATTTCGTATACTTCAGCCTTTGCGCCGTTCCAGACCACGAATGAGGATCCATCGTGCGAGATGCCCTTGACACG
CAGTGATGTCTCAAGCATCGACTGCGTAATGGTCACACCTGACTGCGCGCCATCTTGAAACTTCTCAATTGAAAGTGTTTTTGGCCTCACTTGAATGACT
GCCGTGTCACCACACAGAGCACGCTGCATATTGCCCTCATGCAAGATGACCACACCCTCAACAGTGTTAGCATACAAGGCAGGGTGTGCATTGCTCCAGC
CAATGCGTGTGATAGCACGCCTAATATCCGCAGTAAAAATCAGGTCCCAACGAAATGACACAGTACGCGACGTCGAATTGCCTGTTGGAGCTTCAACGAA
AGACGTTGAACGCCAAAAGAAAACGGTTCCTTGAGCCGTACCTGCCACAAGTACGCGTCTTCGTGGGGAAAAACTCAGGTTGTTGACGCTGTAGATAACT
CCACTTGCCTTCGGTAGACTTAGCACGCTATTCTCTTCAGCTTGGATATTCCAAAACCGCACCAGCGGCTCCCCTGAAGCGATTGCCAAGAGTCCGGGAC
CAGCCCACAATGTTTCGAGGAGCGATCCTTCACCAGCCAGACTCAGTTTGACTTTCGTGACTGGTTTCACTGTGCCGTCAGTTGCTCCCACTTGGTACAC
AATAAGCTGCACCGCCCGAGTGATTACAATCAGTCGGCTTTGCTCCTCGTAGAACATCATCGACTCAATCGCGTGGTTCAACACCTGAATATCCGAGATG
TGCCCTAGATCGTCGGCATAATGCACAGACCCCACTTCACCGCCGAAAAAGAACTGCGGGCATGCATGCTGAGAAAACTGGTCACTGAATAAAACAACGA
CCATCACAGAACAATCAGTCACCCAATCGCAGCTACTAGCATGCTGAGAACCAACCTTTTGGCGTTGCCGTTATTGGGTGGTGTTGGGCGCGTTGCAAAG
ACGCAGTGAGTGAAGCTTCCCTGGCGTGCATACTGCGTACTCAGCGTGAGTTGGCAGCGACTGTCCACTTTCCAAACTGCGAAGATCCCGTTTTCATCAG
CAGACATGAGCCGGTTGCCGGAGGGAGCCCACTTCAAGAGTCCTACGCGGCTCGAGTGGGGGGAATTCACCTCCCGCGCTGTTTTTTCCTTGAATACCCA
AAGCGAGACCATACCTATATACAGGTCACGGTGTTAGTACTGAACGGCATCGTTACTACAGAGAGACCTACAGACTTACCGTCGCTCCAACCGACTGCGA
GAGCGCCACCACGAGGCTGCCAGGCCATAGTGACGACATCGGCAGTACGTGAATAATTCTCTAATCCTTGCTGTTTCTCACCCTACAGCAATTGAGATAT
ACGTGTCAAATATGCGTCTTTCCTACAGAAAAAGATATTGTTTTCATACTTCATCATTGAAAAAGTGAATCTCTCGGTTCTCCAATGCGACAGCAAGCAC
GGGGTCCAGTTCTCCCCAGACTGAGCACACCTGCCGCAGATTGGCTGGGACCTGTACGTTGTAGTCGTAGAACAAGGCCATCCTTCACTGCCCAAAGCCT
TGGTTGGGATCACACGCTGTGAACCGTCGCAATatccaagttgaagtgacatTCTCTCCAAGAGGTTTGATATTCTATTTCATAGGTTGATAAGTAACTt
tgatgtggtccacctAACTCTACTTGCCAGGTTTGACTGGTCTGCGGCCAACGGGTCAATCAGTCAAGAGGTGCACAGCGACAttgacgatggtgatgca
AGCGAAGACGGAGTCCAAGGGCAAGAGCTACGGCAAAAACACCGGCGGCTACAATGCCAAGAAACGTCCGGCTGGAGGtgacgacggcaagaagtCGTTC
ATGGACCAGAAAATggcaaagaagcagcgcaagatGCAGCGTCCGCACTATGAGATGGTGACGCGTGCCAAGCAGATCTGGAACGTCATCCGCGAGCGCG
ATGtggacaagaccaagcgcGCGACGCTGGTGGACGAGCTGTACACGCTTGTGAAGGGCAAGATCTACGACGTGGCGGCTAAGCACGACGCCTCGCGTGT
CATCCAGTCGCTCATGCAGTATGGCAAGCCGGAGCATCGCTCGCAGAttgtgctggagatgaaggaacACCTGATTGAGGTCTCCAAGATGCAGTACGGA
TGCTTCCTAGTGCAGAAGATGATCCGTTACGGCAGTATTGCGGATCGTGCTGCTATTGTGAAGTGTCTGACTGGTAATGTGGTGCAAGTGGGCACGCACA
ACATTGCTGCCAATGCGCTCGAGTATGCACAGGAATATCTCAAGCCGGCACAGCTTACAGCACTGAAGCTCGAGTTCTATGGACGTGAATTTGCGTATTT
CAACGCGGAGAACAAGCGCAATTTGTCCGACATTTTGGCCGCCCACccagagaagaaggaagacgtgctgaagcacttgagTACCATTCTGAACCGCATG
GCGGACAAGCAACTGCTCGGTCTAGCTTTCGTGCAGTCACTGCTGTGGGAGTACTTGACCAATGCTGACCATGACGACGTTATGCAGATGGTGGCAAACG
TGCGTGACGCCTCGCTGGCGTTGTTGGCCACGCGCAACGGTGCTCGCGTTGTGAACAAGTGTCTGTCACTTGGTGCGGCCAAGGACCGCAAACGCATTAT
TAAGACCCTCAAAgacaaggtgctggatgctTGCAACCACCCTAGCGGATACCTTGTGATTATGCGCATCCTGGACGTGGTCGATGACTCCGTTCTCGTT
CAGAAGTCCATTCTCGCGGAGATGAACGACGAGCTTTATTCGATTGCTATGCACCCAAGTGGACGCAAGGttttgttgcagctgctcagCCCGTTGAACA
AGAAGTATCTCTCCCCTGATGatcttcagctgctggaacCTCCTATGCTTCCCTCGCCTGAGGACCCTAGTGTGCAGGTGGTCAACTACAAGAAGGACCC
GGATGCTCGTcgcgaggagctgctgaagggaCTTCTGCCCAAGCTCGAGGACATGTGCGTTGAGAATGCTGCTGCCCTGATGCGGTCGAAGGAGGGTCGC
GACGTGATTGTCGAGGTGGCGAAGCGGAGTAGCAGTAGCGAATTGGCAGATAGTGTGGCCTCTGCTGCGTTGGCAGAGTCCAGCGAGGAGGAGGGGGAGC
CTCTCCACGCCGATGCCAACGGCCACTACGCATTGCGTCGTCTGATCAAGGAAACCACGTTAGCGGAACCCCTTCTCACCGCCATCGAAGAGCAGTTGCC
AGTGTGGGCGTCCACCAACCGTGGCTCTTTCGTGGTTCTCGCGTTCCTAGAGGCTGAGAATGGCTCAAAGAACGCCGCAAAGGTTGTGAAGAAAGCACTG
AAGCCTGGCATGGGAgacttgaagaagctcgtggaCTCGCAGAAGGGCACTAAATTACTTCTTGAGAAGCTCCAATAGAGAGGAGGCAACTCGAACTTTA
TAGATCCACAagctttttgttgttgttgttgttgttgttgttgctgttgctgttgctgttgctgttgctgtggctgtggctgtggctgtggctgtggctg
tggctgtggctgtggctgtggctgtttTCGTTGGTCACTCGGTGCTAGAATTCCTGTGCAGTCaatcatcatcgtcgtcgccatcgctgtcATAGTCGCT
GTCAGCATCATCGCTATCATTATCAAGACTAtccgtgtcgtcgtcgttgtcgtgGGAAGCTACAATAGGATTTCCTTCTCGCCAATTCTTGACCAGCTCC
AATACCTTCAGTTGCCTGTGGAGATTAGCTAGATACAAGAGCGTCTCGCCGAACTGCTTACAAACTCGAGTTAGGCGATGGTAGAATGCCTTTCGGCGGT
TAATCACGCTTACTTTGTTAGGCTTGTCCACCAGTTCGGTGTCGCACTGTTGCAGCATATTCATCAAGAGATTGACATTTCCGTTGGCAGCCGCGTAATG
CAGTGCCGTCATGCCTTGGGCCTGATGAACATAAGCAACCGATTAGGTGTTAGCTAAAACAACCAGGATGTGTGCCAATATCTGTTTGCGCGCACATCTT
GTTTTGTGAGGTTCGACCCCGCGTTCAAGAGCACCATGCCTAGCTGGTGGAGCGTCGTTCCTCCTTCAGCGCAAAGCATGAGCGGTGTCTGCCCAAATAC
CTACGACAAGCAGAAATGATTCAGCAAGGCAACACGAACTTGAAGGTGAAATCGACTTGGTAGGCTAGCCTACATTTCGAGGGTCAACTACAGCACCGAG
CTCGATGAGCgtttcagcagcaacctTGCTTTCGCCTACAATCGTTAGCATCAACGGAGTTGTGCCCCATCGGTCTTGGACATTCAAGTTTGCACCATAC
TTAGCGAGGAGACGGACGATGTCCAGATTGCCAACTCGACTAGCCCAATGCAACGGTGTCCATCCATCTCTCTGCGCAGAATGAAAGAAAACACCAAAGC
GCAAATTTCACCTGCGTCATGTAAACCCAAGTCGTATTGCTGCGAAAAGCGATCCATCCACGACGTGCTCGTACATCTTTCATGCTGATAGACGCTCCTT
TCTTGAGCAAGATGTGGCAGATGCTCGTTCGGTGCAGCGTGCACGCCCAGTGCAAGGCATTTCTCCCGTCGGAGCCGACCGCATCGATGTCGATTTTGTT
GGCGATGCCAGATaggatctcgtccacgttgTCTATGAACGGCGAGGAGGAGAAATGTCATTTAGTCAAACAACTATTACACTCGATTCATCGGAGATCG
CCATACCTGTTTTCGCTGCTAGTGTGAAGCCATCGGCTATCTTGCCATTTCTTTTCGCTTCCTACGCGTATCAAATCAACAGTatgtgcagcagcagata
caTGAGGTGCTGCTTCACATGCTGGTCGGCATCTCTCATCAGCACGAAAGCCACTTTTAGACATGCAAGGTCTTACATAGTAGGAATGTGAAAGACGCCA
CAACGCATAAGTTGCGGCAGTTAGTGGAATCACCACAATGGCCAAGTAATGTGTCGACCCCGATGATATGCATGTAAAGGTGGTGATTTTCATAGCCTTG
AGGCACTGCCCGTTATAAACGTTGACCATCCGCTGCCACAGAACCACAGCAGGGATCAAAGCCAGCGTCTCGAACAGCGAGCACATCACAGGCACAATCA
ACGAGGCCTCTTTCCCCTCTCCGTTCCAAGTGGGGATTTTGATGTTGAAGGCCACCATCATACTAAGCACGAAGCTAATGATGGCAGCGAGCAGCGCCAA
AACGACAAACACCCTCGTGGCTGCGGCATCGCTTAAACACCATGGGTCACTAGAGGTAACAGCCGACAGGGAGCTGCCACGGACAGAGAGAGAGTCAATC
CCAACGACATGAGGGATAATCAACTACAGCCATACCAGAATCGACTGTAGAGCGCCAGCGGGCTCTCTGCCACGTCGCTGCTATCAATATTTGCGCCTTC
TTTGCTGAGCTTGTACCGCACCCCAATGCCCTGCAGCAAGATTCAATAAAAAAATTCAGACGAGGAGATGAGAAGCAACGCCAGTTGAACCCTCTATGGT
CGAGATTCAGCGTGTAGGCTACTGGAAGCGGGTGCAACGCACCGAGAGGGACCAGAGTCCGATGTCCACAGAGTTGGCGGCGTCTCGCGCCCACTTGTGA
CCGCTGCACgccgtcagcagcatcaacaacgacACACCGCTGCACACATTGCCTGTGCCAGACGGATAAGGGTCAGCGCACTCCGGTTAGAGAGGGAATC
TGCGGTTGCATGTGCCAGCTACGACCGTACCCAAAACGAAGCGCATTTGAATCTTCATGATGCTGTCTGCGCCCTTTAGGTCGGAATTGTGTACCGTTAT
TTCGGTACACTTGGCTTATTTTTCGTTGGTGGTTTCGCCAAACTGGCTGTCAAACACGGCTTATCCAGCCGAGATTCTAGGTTCAGGCAACGCCGATTCT
TGCCATGCGAAGCTctacgaacagcagcacaagcagctggattcgttgttgctgtgcgAGCGAATCTCGGTGAATCAACTGGATCGGTTATTTGGAATCG
ATTTGGACAGGATCAAATCGAGTGAGCAAGTACAACGTCCAGAGATGGGGCGTAGGTCAATCGCGTCACGCGATTGGCTGAGTGGAACAAAACGGAACCT
CGGTCTAGATTCACTTGAATTCACAGGCATACAGATTTTATGCTAAGATAAATCAAATGAATCTTCTGTAATGGCGATCGAGGGGCCGTAGGTATCGCAG
AACTCGGGGTATAGTGAATCGCTATagtttttctttttttgAATCTAGACATGCAGTTCGTCTGTGATTGGCAGAGGGGTTCGCTTGGGCGAATGTGCAG
CAGAAACACGATAGCCTCGACAGTCTCATTTCCAAATTGGCATCCGAGCGCAACAGTGCAGTAGGAAAGCAAGCGTCAGCCGTCAAATATGAACGTCCGT
GATCTTCTAAGTAGTGACGAGGAGGTGCCCATGTGCCCTCCGTCGCCTGCTACATCCACAATCAGCTGCTCGAGTGAGAGCAGCGACTCGTCCGCCTTTG
AGACCCCCAAGCGCGGCTGGGTGGCCCCGTTCCTCCTACACTTGCACCAGATGCTTCGTCGTGAGAACACTAAGATCATTCGTTGGGCAGAGGATGGCAT
GGCTTTCCAGATCTTGGACAAGGAGGCCTTGACCAACCAGATCCTCCCTAAATACTTTAAGAACAAGAACTTTTCGAGCTTCCAGCGTCAGCTCAACTAC
TTTGGCTTCCGCAAGTGGAGCAAGGCTCGCTCGCAGTTCCCCACCTACAGCCGTGAACATTTTGCGCGTGACAACTACAGCGAGATGTCTCTAGTGAAGC
GCCAGAGTAAGAAGTCTCGCAAGCGCAAAAACTCTTCTGGTAGTGAGGAGGAGCAGCCGACTAAGCGAACGGCCATTCCGTCGAGCTACGTCGCTAATGA
GAGCTGCAAGCCGATTCTTCCTCGCCCTGGTGCTTCAGTCGAGTCTTCTGCACCAGTGCAGTACCAGCCCAGTCATATGCCTCGCATAATGTCTCCTCCG
ATGAACCCGATGGTGTTTGGTATGCCGGTGCTTTCTCCTGCTCGGAAGATGCACAACGGCTTCAAGCTGCCGTCTATCCACGAATTGTCACTGTCAAGTA
CTCAGTCGTTCTCGGCGATTGGCCCCATTCGCACCCGTCTGATGGCTTAGGTGCTTCGTTGTTCTATGTGGTAGTAGTTTAACCAACTTATTTATACAAT
TAGTATCATTCACCAACATCTTCACTGTATCGACATGTATATCACTTCGAAGTATGTGGCTTCCTGTGGTTAATGCCGTCACTACAACGAGGGTTATGAT
ATCCAAAGGCACTCAAGCGGGGATCTGACCGTTCTCGTTCAGTGCCgccacttcaagttcttcCAACTGCAACCAACACCTCCACGCCGCATTCTTCGAA
CATGAGAAAGATTCGCCATAGAATCCTATTCCTCCTATCAGCCACCTCATCCCTCTTTCATGCTAATGCTTGCACTATGATTGCTGTGGGTCGGAACGCC
ACCGTCGACGGCTCAACACTTATGGCGCACACAGATGACGCTGGTTATGGCACTGCCGATCTGAGACTAGTGCGCGTTCCAGCTCAAGACCACGAAGAAG
GCGCCATGCGTCACGTGTACAATCCTTCTCCAGGATATCCGCGGCTTGTGACGACTCAGAGAGGTCCTGAATACAAGCCAAAGGACGATGAGCAAGTGAT
GACTCCTCTGGGTAAGATCCCACAAGTCCCGCACACGCACGCCTACTTTGACCAAGACTACGGCATCATGAATGAAGTGCAGCTCAGTATCGGAGAGAGC
ACATGTGGTGCCAGGACGGTGGGCTGGCCTAAGGATGCTGGGCCACATGGCTACAATCTCTTCGGCATTGCTGAGTTGTCGAAGGTTGCGATGGAGCGTT
GCGACTCGGCTCGCTGCGCTGTGCAAACTATGGGAGATCTGGCTGTGCAATATGGATTTTACAGCGAAGATAGTGGAGATCCAGCTAAACCAGATTATGT
GAGCTCAGCTGAGGCGCTAGGGGTGGCGGACCGCTATGGTGAAGTTTGGATCTTCCACGTCCTGACAGGACCACAAAATGCTAGTGCCGTCTGGGCGGCA
CAACGCGTATTTGACACGCATGTGACTGTGGTGGCCAATGGATTTGTGATTCGCGAGATGGATCTGACTGACCCAGACAACTTCCTGGCGTCGGAGAACG
TTAATTCATTCGCCAAGGAAATGGGGTGGTGGGAACCGAAACTAGGCAAGCCATTTGACTTCACCGCTGCGTATGCTGCACCGACTCCTGATCCTGTTAG
GGTATTGTACATGGGTCGTCGTATTTGGCGTGTGTACGATCTTGTGGCGCcgtcgttgaagttggaTTCTCGCCTAGGGCATTACCCGGAGTACCCGACG
TATCCGTTTTCGGTCCAACCAGATCGCAAACTTGGTGTAGTGGATGTGACGAACTTGTTGCGTGATTATTTCCAAGGTACACCTTACGACTTGTCTAAGG
GCCTAGCTGCAGGGCCATTTGGGATGCCCATGCGCTGGGGAGGTGACGAGAAAAGCGTTATTGGGGGGTGGGAACGACCGATTTCTATGTATCGTACTGT
CTTCAGTTTTGTGCTGCAGGCCCGGGCTTACCTTCCCGACGATGTAGGTGGTGTGGCTTGGTATGGACAGAGCTCTCCACACGCGTCGGTGTACGTGCCG
TTCTCATGTGGGCAGAATGAAGTGCCTCGGGCCTACATTCTTGGGAAGGAAAGTGAGTTCACATTTGACTCTGCTTGGTGGGCCTTCAGTTTTGTAAACA
ACTGGAGCATGATACGCTTTGACGCCATCAGCAAAGATATCCGTGCTCATATTTCCAAGTTACAGACGACATGCTTTGCAGCCCGGATGGCTATGGAAGA
ATACGTCTCCAAAACCCATTCCCTGACAGCATCCGGTACACGCGTTTATTTACAAGAGCAATCGAACGAGTTGGCATCGCGTGTCGTTGAAGAGTGGTGG
GCGTTTGCATGGAAGCTTGTGGGCAAATTCACGGACGGGTACATCACTACGGGAGAAGCACCCGAGGAAATGCAGATGCCTGGATATCCTGCGTGGTGGC
TCAAGCTCAGTGGGTTCTCTCAGTGGCCAGGCAAGACACTGGTGCCGCCTCCTGTGGCATGGCTACGAAAGCAACTCGAGGTGTTTGAAAGTCACCAGAA
CGCGGGTACAAGTCTTATAGCACGACAATCAGTATGGGGTGAATCTGTATTATCATCCGTAACTGACCCGATCGCTCAGATAAGCATCGGCGCAATTGTG
GGGGCTGTCATAGGCGCTTCCGCCGTTTGGTTTGCTACTGAGCGCCAACGCCGATCTGGATATCGGCCTATTGCGTAAGCGCGTTGGGGAGAATTGCTGT
GGACGAAAGAATGCGCATCTTAATAGCGGGTGTTTTGAATGCAGCGTTTATGAGTGCAATGAACACGAATGCCATCTACCTGCCATATCGTGTCCGCTAG
TATCTATTGTGGGGGTCCTTGTAGTTCCTTTTGGCTGCAGGGCTTTTAGAGCGCTTGCGCTCGTGAGTGTTACCATTAGACGGAGAAGATCGACTAGGGC
GAGGGGGCTTGGGTGAGCGCTGAAGCCTGTTGTCGTCACTAAAACCTCGCCACAAAGTGCTCACCATCTTCTCTTGTCCTTCGCGGTTTTTGGTTTTCGG
ATTGTCGTAGTCGGGCCGACGTCTTTCATTGCGAGTCTCGTTCACAAACTTCCCTAGCTCTCCTCCTGGCCCTTTTTGCCTAGAACTTGCTCCATTTCTG
GCTGGTTTGGAGGCGATCGTGAGGCCTGGCGTGTCCAGCAGTCCCATGGCTCTCAGAGTCTTCTTTTGCAACGCCGGCACCTTCTGCAACCCAATGAGCT
GGCTGTAGAGAGCACCTGTCTCGACAAGTTTCTTCTTATTCATGCCTAACTTTTTCAGGTTCGAGTTGTAGAACCCCAGGAAAGCAGCATATGCCTTCTC
CGCAGACTGTTCCAGTTCGCTGCCCTGGCGAATATGCGCAAGGGCGCGTGTGGTTTGGTAGTTTTGCTTGTCGAGTtgcggttgctgcttcagctcagTG
AGAGGCAAGTCGGCCAGATCACGAAGCATCGCTTTTTCAAAGTCGGCCAACACCAGTACGCCACGACCCTCCATACCCGCGCGGGCAGTTCGTCCCAGTC
GGTGAATGTATTGGTCTCGGTCCGTGAGACCAACCTGGAGTACAAGAGACACGTCCGGGTAGTCGACACCACGCGCCGACACGTCAGATGAGAACATGAT
GGTCTTCTTACCCTTGCGGAAGGCATCCGCGGCTTTGGTACGCGCGGATTGACTCTTACGTGAGTGCATCTCCAGAACCTTAGGGAACCCTGCAGCCTGG
AATAGCTGTGCCATGAACTGAGCCGATCGCGCTGTGGGCAAGAACACAATCACCTTATACTCAGGCAATTTCAtgtgctcttccagcacacCTTCCACCA
CGGGAATCACATCTTGCAGGTCACACACCGTGTATTCCTGGACAGTCTGTGTGTTGGTCTGCTGGTCATCACCTTCAATGGTATCCACAAAGGCAAAGTC
GTCGCGAAGTGCCACATCCTTGAGTTCATTCGTTGTAGCCGGCAGCGTCGCGCTGAAGAGCAGTGTCTGCCTTTCACGGGGTAAATGGCTGATAATCCGC
AGGATATCCGGCCGGAAGCCCATATCCAGCAACCGgtctgcttcatccagcaccaagatCTGGAGATCTCCCAGTTTCTGACGAATCCGTCCACTGTTGT
CCGTGAGATGAGCTTGCAGTCTGCCAGGAGTGGACACCAGCACATCAATTGAACCAGGCTGTGTCAACTCCTTAATATCTTTATTCACCGAGCTGCCGCC
CACAAAACAAGCCGTGCGAAGTCCATGGGCGTTCGTCAGCTTGACTGACTCCACTGCAATCTGCTGCGCCAATTCCCGAGTGGGAGAAATCACGAGCGTC
GAGATCTTGCCATGCGCAGGCCGAGGATTGGCCAGCATACGCTCCAGAGCTGGCAATAAGAAGGCGATGGTCTTGCCATTACCAGTCTTTCCCTTGGCCA
ACACATCGCCgccttccagcaccaacggCAGCGTGTCCTTCTGCACGTGAGTGAGGAATTCGTAGCCCATTTCACCAGTCAAAACATCCTTCGACGCCTG
GCTGATAGGCAACGACTTGAACGAAACATCTGACAGGTACCCAGCAGAGGCCCATAGATTGCTGGTTGAATGGAAACCATGGCGACTGGGACACAGGACG
CGTGACGACTGCAGCCTCAGAGCCGACGACAGGCGAGACGTCCACATTGCGTTTTAAACCACCCAATCTGTTGACTTTTTTTAGACTTGATTACATTTGA
TTGCGACTAAATTACAATTACTAAATTTTGTCTGGACTAAAGTTAGATAAAAGTAATTGTGATAACTTTCAGATTTTTGTGTATGCCTATATATCACTGA
AGGGCCACAACTAAcatttgaagagcaagattACCCTTTTTGTGCTCCCCAACTGTGGAGCCGGAAGTGCCAGAACACTGTAGGAGTCGGCGCGGAAACC
ACTTCTTACCACGTTGTGTGGAAATTAACCCCGGATGTCATTAAATTATTCCCACCAAAAATCACTTTTTGCCACCCGAGGCAAGCTCCCACACAAACGT
GCCAAGAAATGGTTCCCACATATTTTGGGCGGGCGGGTGTGTGGGGAGACCCAATACTTAATGGGGTTTTGGATATGTGGTTTGGTAGAGGAGTGTATCA
GTTAGGGAGCACATGCTCGCTAACAAAAATTCTCCTACCTCAGTATCAGCGAATCGACCCTTCCTGGACATGCCATAGATGCTCGTCTACAGTGGACAAT
TGACAAGGTGGGTTCGAGTGGCGCGAGATAGGATTCAGTGCTTTTTTCTTATGAAAAGAGATGGACGTTGGATGGTCTAGATGGTTTGAAAAAGTATTAG
CACATCAAGGACATCCCTGAGAGAATTGTAGTGCGCCAGCCTTCTGATGGTGGCGGGGTCATGGTGTGGGGCGGATTTTCAAGCAAAGGCACGACCGCGC
TCGTGTTTGTTTCCCAGTTCATGACCTCGATCGTGCACACAGAGACATTGGAAGCCAACATGATGCCTTTTGCATGGGAAACCCACGATGCATCGTTCTT
GTTTCAGTAGGACAATGCCCTGTGCCAGATAAATCGAGCGACAATGGGGTGGTTTCGCGATCGCGGAATTGAGGTCACGGCGTAGCCAGCGCTCTCACCA
AACTTGAACTCAATGGAAAATCTATGGGCACGTCTCTCCAACAAGCTTTACGCAGGTGGACGCTAGTTTTCTAGCATTTTACGTCTCAAGGAGGCAATTT
TGGCAGCATGGGCAGAGATTTCAGCCGACAACTTATTCGTTCGATGCCAAAACGCTGCCGAGAGGTTCAACACCGGTGCGGAACATTTACAACGTACTAA
ATGCAAAAGTTGCCGTGGTTTCATTGCCTCTTACCATTCTTACGCATTGCTTGGGAAACCTCTATAACGAAATATTATGTCATTTCTCTGCTGGTATTTG
GAATGTTCAAGCATGAAAATTATACTGAAAACCGCATTTTCATTGACTTTCAGAAGAATCCGTTGGAATTGTGATTGGACAACATTAACAAACTTATTCA
CTAAAGTCGATTGTCACATTTATCGCTTTGTCGCGGAGTGTATAGGCAAGTAAGAAAAATCTGATAGCGAACCCTTTTCGCTACCATAATTCTTTAACTC
ACGTTGATTGGTGCCTCTATTTTTAGTCTTGACTAAATTTAGTTGATGTGATAACATCGCAGAGTGACATTTGTGTGTTTTTATGAAATTGTCTCGCCCT
AATTTTGGTTGCATACTGAAACGAAGGTACACCGTTTTGACAGTTTCAGCTTTCTATTCTGGTCCTTTTTGGTGTCGTCTGATTGATGACCATCTCATTA
TTCGACAACTCTCCCAGACAACGTCAGACGAAAGGAGACCGTAGTAGACGATGGCGCTCGGACAACTGCTGCGTGTTGCGGTAGCATCGTTAACCTTGCT
GGTCACTATTGCGCCTGCACCTTCAGACGCGATGATCGTCAAGCTTAACGGCCGCGTAGAGGAGTGTTTCCACGAGTACGTACGGACCAAGCGCACGGCC
TTCATGAAGATCGGCGTGTTGGAGTCCACAGGCGCGTACGACGTGCGTCTGAAGGCCTTCGGTCCGTTCCCCTCGTACCCAGAGGAGGAGCAAGTGGAGA
AGAACTTCTTCGACCAGTTGGTGGTGACGCCGCACGACGAGCAGAACCAGAACATTGAGCACAGCGGCTTCAACTTTGAGTCGGAGCACCGTGGAGGCTG
GTACCGCTTCTGTCTGGACAATACGCACGACAGCAATGCGCGC