Description :
From Genome Similarity Track
Location :
Scaffold_2000:500- 2225
Transcript NameFunction/comments
Physo_145631predicted protein

Sequence
1725 bases(100 bases per row)
GCGCTTGTAGCAGCCCTCGCTCTTGCAGAGGCGACGGCTCTTGACCTCGCCGGGCATGACCGTCTTGGGGGCCGCCATGTGCGGCTCCGGGCGACGCGGG
GTCAGCATGAGCTCCGTGTCCGTGAAGTCGGCCTCGAGCGACTCCATGAGGCCCTCGATCGGGGAGCCCGCCAGCATGTTCAGGTTCAGGATGCCGTCGT
CCACCTCGGCCGCCTGCTTCTTGTCCTCGGGCGCGTCCACCAGGAAGCTGTACAGGATCGACATCTCCGTGCCGTCGAAGCCGTCGTCCAGGTTCACGAG
GTCGGGCTTGTCCTTGCCGACGCTCTCCAGGTCGCCGGGCATCGAGAAGTCCAGTAGCTCCTCCAGCTCCTGGGCCTCAAAGTTGGGCTGCACTGCGGCA
GCAGCGGCCGCCTCAGGCTTGACCTCGGCGGCGGGGGCCGGGGCGGCCACGAACTGGTCGCTGGGCATGCCCAGGCTCATCAGGTCGGCCGTGGGGGCGG
CGTTGCCCCAGGGCATGGCCGGCAGGTTGTTGGTCTTCGGGAAGGACACGAACGGCAGCGCCGGGGGCGGCGCCGCCATGCTCAGCATGTTCATCGCGTC
CGCGCCGAAGCCGAGGTCGCCGGTGGTGGACCAGGCGGGCGCGGCGCCCGCCTTGGCATTCTGGCTCATCATGGCCATGCTGTTGGCCGTGCTCGCGGCC
GCGGGCTGGTAGCCAGCGAACAGCGCGACGGCGGCCGGGCCCATGGCGCCCAGCGAATCGCGTGACTCTATCGGCCGGCACATTCTCGGGATGCTTGGGG
GTCAATGGTGGTGTTCCTGTGGGTTGTCTGTTCCGCTCTCTCTCGTCTCTCTTCGCACCTCTCTCTTTTCGAGCTCGTTGCGTTCTAGGGGGCCGGTGGC
TGCCCCGGTTTTTCTTCCACGGTAGCAAGCAACGGCGGGTAAAACGGGCTAGGGTATGCCGACGGTCGTGCCGACCCACGATTGGTGCAAAAAGAGTTTC
GGCCAATCGCCGCGCCGTGTTGAGAGAGTCAGCGCCCGCGCCGGACTTGGCTTCACTATGCCGGGAGACAGACCTCGGACACAAAGACACCGCGCCACGC
TAATCGTCCCGGGCGGCAGCTGGCCGCAGGATTCCAATCCTGCGCTCGCAAGACGCAACTCTTTTTGTGTGGGCCCTTCAACTCGTTCACCCCAACTCGA
CGATTATACGCATCCTTGGCCGCGGCCAGGAGAGGCGTGAACGCTGCAGGGCGTTACGGTCCTGCTGGGATGTGGTCTGCTGGGTATATATATTCGCTGC
TGAATTGCCGTTGCACCCATGCTTCAAGGCGCTGCTGGCGCGCGTTGGTCTAAAGCACGGCCGTTTCACTGAAAGCTCCGACAGCGACGGTAGCTAACGC
TAATGCGCTGCCGTCCAAGCAGCTTCGCCGACCACATGGGCGGCGGTCGTCGCGGAAGCGCAAGCGCAAGGCTCGAACGTGCAGGCCCCGCCATTGGGGT
CGTCATCTGTCTTGTTTCACCGCGTGCTGCAGACGAATGTGACAGGATCAGAGACCAGGATTGCAAAAGCGGCTGGGGGCGACGGCAACCCCGACACTGC
TGCCGTCGCCGCGCTGCGGGGCGGCAGGCGGTGCAGGCCGTCGCAATGAAAAGCAAGCGATTAAAGCCGGCGATGCTGCCGCGAGGCTTCTCTGTTGACA
GCGCGCCCGCCGGTACAAGCTGCAT