Description :
From Genome Similarity Track
Location :
scaffold_58:500- 1903
Transcript NameFunction/comments
Pl_110869integrator complex subunit, putative

Sequence
1403 bases(100 bases per row)
TATGACACATGGCACTAGAGCCATCGCACCACATCTATTGACGGAATATTGGTGAGGGTACAGGAGAGAGATAACTAGTATATGTAAGATCTGACACTGT
GTCTGATGCTGCAGGACTGGGTGCCATGGGAAGGTGAAAGATGGAGGCAGTGGCTTAACAGCTCCATACGATGTCCAGGACATCGTTCCGGCCTTTAGAA
AGGTTAAGGCGGTAGCACTGAAGGCCTGTGTTACTGTGAATGAGCATTTAAAGGTGACAGCATATCATTCAGGTCATGTGGCAGGTGGTTCAGCTTTCTA
CTTGGAGATCGGAGCGACAACGGTTTTGTTCGCCAACGACTTTAATCTCACTGGCGGACGAGTGCTGCTACCAGCGCAGATTCCGAGGTTGGAGCCTAAT
GCTCTAATTACACGGAGTTCATTTGCGGTGACTGTGTCGGAGACGCAGAGCGCTATGGAGCGAGAACTTGTAAAGGTTATTCTGGAGTGTATCAGCTCGA
ACGGGAAAGTGGTGATTCCAGTTTATCGCTTGGGGTACTTCCACGAATTGATCACGATATTGCTGGAACATTGGCAGCAGATGAAAGATGCTATCGGCAA
GACTGTGGAGTGTCCGATATATCTATCAGACGCTGCTATGGAGTATCCAAGCAGATTCCTCCCCATGTTGTCTCGCACGTGTACACCTGCTATGCAGAAT
TTATTGCGTGATAGGTCTGCTAATGTTGCTGATCTCCAAGTGTTTGACTGGAAGAAGTTACAGCAACCAGGACCGTTTGTGCTGTTCACGGGACCTGCTA
ACATCTCTCAAGGTGATTCGTTGCGTGCTATAAAGAGTGTTGCGAGCGACCCGAAGAACCTCATCGTGCTATCAGAGTATTGCACACCGGGCACAGTTAA
CTATTTACTGTATGCAGACCCTGAACGTAAGCGCGTCAGCAAGCGCCTAGGAGTGAATGTGGAGTGTGGAGTGCACTACCAACCTTGTGGAGATGAAGTG
GATACCAAGAGCATTATCCAGCTCATCTCGCGTGTGGCACCTCGTCAGGTCATTCTCGACTACACAGTTCCAGATGACCTGGAATTTGTTAAGACTCATG
TCCAGAACCAACTGAAGATGGATCCAGCTCTTGACACCGGTGTGGTGGTAAAGGGAATCAATTCTGCAGGACGAACGCCCATCGAACCTTCCCGCGACAT
TCCACTACGCATTCACAAGGCAATGTTCAATAATCCTTCGGATGTACAGGGAATGCTGATTGCCGAACCTAAGCGCAAGTTGATGCTAGTATCGAGCGGC
AACGGCGCACGGCGATTGAAGAAGAAGAAACACTCGCTATTCTTTTCATACTCCTGGAAGAAGCCGTTCGAACCATCTCCTCGCGTGAAAAAGAAAAGCT
CTC