Description :
From Genome Similarity Track
Location :
Scaffold_1268:500- 1775
Transcript NameFunction/comments
Phyag_g10110hypothetical protein PHYSODRAFT_323479
Phyag_g10111hypothetical protein

Sequence
1275 bases(100 bases per row)
GACCCGCAGTCCTAGCCACTGTGCGAGGCTGACTTCACTTgattgctggacgagaaACCGCGTGCCGTCGTCCAGCCACGCGAGCGCGTCTCCCTCAGTC
TCGCTGTCCAGAAAGaagtgcagcttctccagaaaagtcctccagctccagtctTCTCCCTCGTAGTCGAGTCCTGTTTGGATGGAGCCCAGTTGTTATT
ATCCTACTACcgcagccaagaaggagcagcaagcTATTCCGACCGTCTCGCAGTAGCTTCAGGTGCTTCAAACTGCGTTCATTCTTGACGTCTGCGCTGT
CGTCTGAAGAAGAGATTATATTGTGTTAGAAGAGCCCCATCAAGAAGGACAGAGCCATCGCTGCGTGGTGACGCACCGCGTGCTCGCCTCCCCATGCTTG
TTGGTATCCGCAAAATgcgcacttcaacttcaacttgtggCTTTTGAGAAGAAGCAATTCACGGATGAATTGAAGGCGGCTTCAATTCAAAGTGATGCTG
GTTGGTTCATTAAAAGGAGGACGCGcgagaagagaagagaagtGGAGGCTGCATCGTTGATGTGGAAAAGTGTGTTCATCGGGATCAATGGAAGCCCATT
GCACCTTGCTGCATCTTTCAGACGGGACCTCTCTTTTGGATGACCCCATCTTAGAGCATTTCGTCCCCACAAGTGGACCAATCTGCACAAAGATACTTGA
CACCCCATTCATTCCCTGATCTCGCGGAAAGATAACAAGCATGGGAGGTGGTGATGTTGGAGCTGCATTCGATGCTGCATTGACCCGTTCGGGGACGTCG
TTGACGTCGAGGGACTTGGTCGAGATGTATCCTCCTCTACCTTCCAAGTCTAGTAAACCCGTCGAGCTGGATAAATGTCGATTCTACGATCTGTTTAATG
CCGACCCAGTCCAAGTTCgcaaggagatggagaaacaacgcgaagaagctggaaaGACTCATGGGTGGGAGTTTATGCAGCTTATCAAGAAGCTAAAATC
CCACCATCCACTAAAGAAGAATCGCCAATTTGACTTCCGACTAACGtcagaggagaaggccaaaCTGGAAACCAGTGGAGTCGTTGCAGTGCAACGCATG
CAAGCCCAGAGCTTTGCAGAAATCTACTACCGACTGTACACGGACGACCTGCCCGTCTTCGTGACGACGGACTCCATCTTGCACGCGTGGCACCGAAGTT
TCGATGCGTTCCTAATTGAGttggagaccaagcagctAGCTTTGATGCTGGACAAAGTGTTGAGCTCGACACTGG