Description :
From Genome Similarity Track
Location :
Scaffold_201:50- 5997
Sequence
5947 bases(100 bases per row)
TCACACCAACAAAGGAACAAACCTCAGCTGAAATTATCCAGAAGACACTGAGCCAACGCTCACAACAGATGCAGAAACAACGAGGACTAATCAACAAACA
CATAGCGGATTTCCGCGCTCCAGCTACGAAACAAGCGCTGGAGAAGATAGCAGAACCAACTATAGTGCAACAAGAAGGAACGGTGCTGACAGGACAGCAA
GTACTGCAAGCGTGTGGACTTGAAGAAACAGCAACACCAGCAAACGGAAACTGTCAATATTATGCAGTCGCAGCAGCGCTTCTAAACCGAGAATTTCAAG
AAACCAACAGCACCTACCCGCTTGAAATCCTTACCCACAAACTCAAGAAGGGTATAGCAGCCGCTAGTGACCATTTCTTTACTGAAGAATTTGATCACAA
CACTCGACTCAAAATCCTAACAGGAATCGAACGCTCAACTCAAAACTTACGCCCTGGACAATCGGCGCAAGCTCTGAAAGCTCACTTCCTAGAACTGGGC
AAATCGGAATCACGACGCAGTGGATACATTTCGGGACGTCACTGGGGTAATGACGAAACACTGCGAATGCTCGCGAAAATACTGCAGAGGAACATCTTTG
TAGTGATAGCACGACCAGGACTGGCACAAGCGACGTATCAGCAGTTCACACCGGCGCGGGTAACGAAATTTGGTAAAACATACAGCACAGCTAAGGAACG
TAACTACGAAGCGGAACAAGCTCAGCATTGGATTAACCAGATTCGCCAAGACTGCAAGGAGCGACAGTCACCAGAAGAGCTACCGATAGTACTATTATTC
AGACCAAAACATTATTGCCACCTTCGATTCAACCCCAAGGCGGTAATAAAAGGACTTCAGACCGACCCTAAGCAAGCCGAACCCAAGGAAACCAGCTTAG
AGGACGAAACTATGAGCTCTCTAAGTGAAAACACTGATGAAGTTATGAACGAGCCAAGCGACGACGCAGAAGGAGGACCGAGTGAACAACAGCAAGCGGA
CAACAAAGCCAATGAAGGAGATCGACAACTTACAGCAGCAGAAATTCACGAACGCAGCGAGGAGCAAATTAACGGAAAGGGTCGAGAGGAGGAATTACGA
GTGTTCTCAACCGCTGGAATTGATGGAATTGCACCTGGTAGGAGACAGGATTTACGTGACTTACAATGGTTAGATGAAGCAGCAGTGCAAGAATGGATGA
AACGGTACGACGTAGATCAAACAACGCTAAAACAATGGCAAGATGAACTACTGGATAAAGGACCATCATCTATTTTTACTTCGTCACAGTCCAGCGACCC
TCACTCAAGCAGCTCGGTATGGGAACAAGACGACCCAGAAATCCTACCAGACGCGAGCTCCAAAGAGATAGACAGCACAATAAACCCACATCCAAGCCGA
TTTGACCCCAACTATACTACCATCGGTGCTAGTAGGGCTCGACAAAGAGAACTACGGAAGCTGTGGCACAAAGAAGCACCGAAGTGGGAACAGGAGACCA
CAACAGCATTCCCTACACTACCAGCAACAACGGAGACATGGAAATCGGTAGTGACGCATGCTCAAGGGACTTTGCTATCAACGCTTAGAAAGTATCAATC
TCCAGAGTTCATACTCTCAACAATGACAGACGCAGTACTGGATTCTTGGACTACAGCGGCTCGCTTGGACTGCCTGATTCACTGTCTAGGTCAACTGGCG
GAAAAAGCTGGTGAAACAGGAGACAGCACCAGCACAAACTGGCTGGAGTTATGTATTGGAGAACTGCAGCAACAAGCAGCGCTAAATCAAGAACAACTCA
ACCTATTCCCGACTGAACTATGGAAGAAACTGAAACTGATGAAATGTGGAGACATGGAATTACTCAAACTCTGCAGTAAGGGACGACTGAAATATTTGTC
GAGAATTATTGTAGCAGCACATGTGTACACCAATGAACTTCAGAGATTAACTAGGAATTTTGGAGGCCGACAACCCACGACCACAATTGAGTACCTCGAC
ATACTCTTTGAGGTCATGCAAGAGAATGCAGCTATTAACGCAACTATCCACCAACAGGATACAGCTGGGGTATGGGCCAAGATCGAAGAACTGCTCACAT
CTCGGTCCAACAGAGTCGAGATTATTCCAGAAAGCGAGTCGACAGGGCAACAATAAATCATGAATCAGCTACCGAACAACAACCCTCCGGAAGGAGACTA
CTACAGTGACCTACACAACATAGCTACTTTATTTGAACAACCACCAGTAACACGACGACACAAACTAGGACCTCGAACCAACTTAACCATCAGCACTCAA
AACTTACGTGGATTTGCGAAGAAATCACGTCGACAATGGATGAGCGGGTGGCGTAGAATTCGAGGCAACCGAAGACCTGATATTATTTTACTCCAAGACA
CACAACTAAAAAACAACCAAGCAACAAACAAAATGATAGACCAATGGCAAAGAGCATGGCAGATATCTAAACCAGACCATGACTTGAGCTACTGGACAAA
AACAACGACGAAATCAGCAGGACTGGGTATCCTAGTAACACCCGAAATCAGCGCTCGAATCAAACCATGGCAGCAAGCAAGCTGGACATCACGAGTGATG
GCAGTAGAACTTGATGAATGGCTCATAATCAACATGTACGCACCTGCGCAGCACAAAGACCAAGACCAATTTTTCGCAGACCTTGAGCCGTGGATATCAC
AACACTCCTCCATTATAGTCGGAGGGGACTACAACTGTGTACTACAACCTCACCAAGACCGAGTAACAGCCAGAAAACCAAGTAATTCCAGCAATGAAAG
CAAACTTCTCAGCACACTGCTTGATAAGTGGGACTTCACTGATGCTATCAGCCTCTCACGTAATTTGGATGACGATGAAGAGGACCACGACCCTCTCCAT
TACTATACACATTGGACCCAGAACGGAGCCAGTCGACTAGACAGATATTATGTAAAAGGAGAACCCTTTACTGCAACACAATGGGTTAGCGTGCTGGAAG
CAGCGCATAACTCCGACCACCGGGAGGTGAGACTGGAACTCACAACAGGAACAACGACGACTACGACAACAAAACGAATACTGCACTACCCTATCCAAAC
AGGCAGACCCCAACGGGTTAAGGAAGCCATTGGAAAAGGACTTAGTGAAATTATGGACATATATGAACTAACACAAGACCCGGTCGCTAACTGGGACACA
GCCATTGAAAGTATTCAACAATTACTTCAACAAATCCAGACAGCGGACGCACGCCAAAGCAAAAGGTATTTTGCCAATATCCGAGCATCAACTAGGATTG
TTCGAGTTTCTCAACAGGAAATACAAAAAGCAGCACAGACTGACGCTATGAACAAAGCAGCACGATCATTTGGTAGGAACTTACAAAAAAATCCGGAAAA
CACAAGAGCGCACTTCAAGAGGAACTCAGATTGGCAACGAGATCAGACAGTGACGGAGATTAAACCATCACCAGGTCACTTCTACCCAAATGACTATCCA
ATTGAAGAGAGAATGGCAGCGGAATGGAGCCATGTGTTTCGAAAATCCCACGCTACGAGTGACCCAACTAGACGAGAAGGAATTCTTCAGAAGCTGGCCA
CTATACCAAAACAACACAGACTAACACCAGAGGAAGCGGAAAGCTTAGTCTCACCGATCTCGGAAGGCGAAACTAGGGCAGCAATTGAACATCTCAAACG
GAACAAAACAGGCGGGACAACAGGTCTCAACCACGACTTCTACAAAGACTTCTTCGAGGTACTTACACCTGGACTTACAAAACTTTTCAATACAATTCTC
GATGGCGCAGGAGAAGTACCTCAATCCTTCCTCGAAGCAACTATAGTACCTCTGCGGAAAAAAGGAGATTCCACAGATGCTATGGACTATCGACCTATTG
CCTTGCTAAACACGGCATATAAACTTTTCGGACGAATTCTAGCAGATCGACTCCACCAATTTCTCCCAACACTCATTAGCCCAGCACAACAAGGCTTTGT
CAGAGGAAGAAACATTGACAAAACTGTCACGATATTACGAAACGTATTAACAACAAGTGTTCATGACCCAGTCAAAGCATGGTCAGATTTATCAGCGGTC
CTGTGTCTGGATTTGAGAAAAGCCTATGACACCCTTGACAGATCATTCATGCTCATGGTACTCAGTAAATTTGGCTTCTCAGAAAAATTTATCTCAGTTA
TACAGCGACTACACAACGGAACCACAGCTCGATTTCTTGTCAATGGCAAAACTTCAACCAAATGGACAGTAGGGTCAGGAATACGCCAAGGGTGCCCGTT
AACGCCATTACTATTCATTCTGGCAGTCGAAATTCTCAGCCACGCAATTGATCAGCAACCCGAAATCACCGGCATCACAATACCAGGGAACTCAAAGATC
AGACACAAGTTCTCAGCCTTCGTGGACGACAGCACAGTGTACATGAACTCGCTAAAAGAACTACCAGCAGTACAACGGACACTACGAACATTTGGTGAAC
TCTCAGGACTACAGGTACAACCGGAAAAAAGCATACTCATCGGACTCAACACCGCAGGAACGCCAACCAAGTGGCAAGGATACCCCGTTTTACAGCCAGG
AGAGACGACGCGGCAGCTGGGATACTGGGTAGGCAACAAAGAAGCAACGACAGAGAACTGGAACATCCGGATTGAAAAGATACAACGACGCCTCAGGATA
GCGACCACAGTAGGGAACTCGGTGGCACAGAGGATCATGCTATTCAACGTGATCGCACTACCGGCAATTCTCTACACGGGCAAGCAATTCATCCCACCCA
AATCAACACTTAGACAACTCGAAAACATACAGAAACAATTTCTATGGAGAGCATCCGCGAGCACAGAATCCAGCACTCACAAAATCAATGCAGCTTTACT
CTTCTCGCCCAAATCAGCAGGAGGATTAGGACTTCAGGATATCTCGAGAGCACTCCAAGCAACTCGCTGTAATTTGGCGGAAAAATGGCTAAACACACCA
GCGGACGTATACACGGAAGCGTGGCACGCTCTGGAGAAGCAACAACGGACATATGCTGTGCATTTCGACCGACCTCGAAGAAAATGATTAGCAACTCAAC
ACGAGAAACCAACGGACAACTGAGAATTTCAGCACAAGCCCTGGGTAAACTAGAATTATGGGAGGCGCAGTCACAAGGACTGCTTCGAGATGAGGGCCAG
GATGACCAACTAAGACAAGTATTAGCAGCAGGACCAGCTCACGCATCTAGTTTCTGGCTTACCGATGACACAATCTACTTCAGATCGTCAAAAGTGACAC
GAACAGCAACGCTACCAGATCAGGCGGCATTTTTACTTCAAGCACCATGGGACAACAATGCATACATCATTGACAAACACGGAAAACCACTACGGAGACA
AGATTTTTCAATGATCCCAACATGTCGAATCGCTGATATCGAGGTAACAGCTATGACGACGCTAGTTGAAATTGGAGAACATGGCGCAAAAATCAAACCG
AACACAAGGAAATCACTAGCTAGGGGACGGCAAGAAGAACAAGTCAGACAATGGTGTAACAACGTGCTCCACAGCGTACCATGGAACTTGTGGGAACAAC
CTGAGCACGCAGCTACACCTATAACTCTCCCCAAGATCCAGATGCAACTTAAGTGGACCAATGATCCAACTCGTGAGGGCAGCATCATTGCAACGACAAT
GATCAACACTCACTCACCAGTACTACGACTAGAGCTATGCAGCGACGGGTGGACTTGGAGAATTGCATGGTCGGCGACAAATTACAAGAACAGCGAGGAC
TACCAAGAACTACAAGCTTGGATACGTGTTGTTGGCATAGTATTCACCCCCAACCCGCAAACAGCCTTATATCCATGGACGGCAAACACAGCGACAATGG
CCAAGAACATCACAGCACAACTTCGACGACAACGAACAAGATACTTT