Description :
From Genome Similarity Track
Location :
Scaffold_109:50- 5705
Sequence
5655 bases(100 bases per row)
ATGTAATGGGCCCCTCCATTACATCAGTAGGTAGATTTCTTTACATAAGTAGGTGCATCAGCCACGACTAGCGTGTGCTGAAATGCTGTCATGCCATTGG
TGATATATGGCGAGCCATACCCATTATTAGCCAATTGGACTATGTCGTGTATTTGAGTGGCTAGGACTGTGGCCTTGGTCCTAAAATAAAGTCAGAGTTG
ATTTTTCCTTAAACCTAAGACTCAGTCGTCCTATTGCGAGCTTCCTCAACACTATAGTGTAAGCAAGTAACGGAGTAATACTTGGCCCGTTACACCTGGT
AGCACTTTGTAGTCCTTCCAACGACCAAGTTCGACATTAGCCAAGACCTCGACCACGCTGCCTTTCTCCATCTCACTCGGATCGAGTGGGAAGCTCTCCA
CCGCCTCGCGGCGGTGTCCGGAGAAGCCGTCGTCACGTCGCTGCTGCGCTCAGCGACGCCCGACGAGCAGCGCGTTGCGGCACAAGAATTCATGGAACGC
GAGCTCGCCGATGCGAATCGGCGAGTGTCAACTCCCTCGCGTATCTCCACGAATGACGTCGTGAAGCTAGAGACGTCCACCTACTCCGGTGCCGGAGAAG
ATCGACTTCCGCTGAATCGCTGCTTTCGAGAAATCGACATCGCCATCGCCTCGAGGTTGATCGAGGCGCCTTCCGCGAAGGTCCATTTCCTCCTCTCGCG
GCTGTCTGGGAAAGCCAAGGAATGGGCTCTCGGCAAGTTGGTTGTCGATCCCAACGTCTTCCCCACTCTGGATACCCTCCAGAGTGACCTTCGGCTCGCG
TTCGAGCCGCCGCAAGATGAATCCCGAATTCGGGCAGACTTCTTCGCCCTTCGGCAAGGCACGATGACTATGCGCGACTACGTCCAGAAGACACGACACC
TCGCGTCGTGCATCGTGTCTAAGCCGATCGATATGGCCTCTCAGGTTCATGTATTCGTGTTCGGTATGCGCGAAGGCATGACGCGCTACTCCCTTACAAG
ATCGGACCCCTCTACGCTCGAAGAAGCATTCGCCCTCGCCCTACGCGAGGACTACGTGGTTGCGGCGTCATACGCTCACGCGCTACCTGCTTCTGCTCGG
GATTCTGCGCCCGAGCCCATGGACATCGACGCTATCGATGCAACGAGCAATCGTCATCGTCATGCACCGCGTCGGAGCGGTGCTCGCAACAATCGTTCTC
TCACCTGCTTCCACTGTCGGAAGGTCGGTCATCGCGCGGCGGAGTGCCGCGCGCCAGCTCCAGTGCTTGCGCATGTCGATGCCGAGCCCGTGAGCTCTGA
CCAGCCAAAAACGGTCAGGGTCAGTAGGTGCGGGGCGCCCTACTGGCTGGAATGAAGGTCCGGGTCCCCCGGTGGCAACCCAACCTCCTAGCCCTCCTGT
GCTCCATGCACATTTTCATGCCACCACCACGCCGAGCGATTCAAGATTGATCATTGTCAGTCTTCATGTCGCCGGTGCCCGGCGACCACTGCGAGCGTTC
TTGATTCAGGAGCGACCAACAATTTCTTCCGCGCGACGTGCTTGTCGGTACTCCCGTCGGACATCACTGTCCGCAAAGGTAGAGGGGCGGTCGCTGTCAA
GTTGGCCGATGGGAAATCACGCCGCGTCGCGCGGCGCGAGATTACACTTCCGTACACGTTCGACGGTTTCCAAAGCAACGACGACTTCCTCGTCATTGAG
ATGAATTACGCGTTTGACTGCATCCTGGGCATGCCGTGGCTGACGCGCTATCAACCAGAGATTGACTGGCTGGCCCGGTCGGTCAAGCGCCGCAGTGATT
ATGATGTGAGCAAGGTGTTCACGCACCTCCTGGTCGCCCAGAACGATTGGCCTCACGTCACCGTCGTGGACCGGTCATCCACGACGCACGTTATGCACAG
AGTGAGCGATGGCCCTCTCTGCACGGCTTGCGCAGTGCTGTTACCTGACGAGTCCCCGCGGCGACGCGGGGATGAAGACCAACTGGCGGTCGAGCAGGGG
CTCCCGCAGATGTACGAGACGGCGGTCGAGCAGGGGCTCCCGCAGACGAATGAGATGGCGGTCAAGCAGAGGCTCCCGCAGACGAACGAGATGGCGGTCG
AGCAGGGGCTCCCGCAGACGAACGAGATGGCGGTCGAGCAGGGGCTCCCGTCAATTGAGCCGGTGGTCGAGCAGTTGGCGCTCCCGCTGAACACTACCGC
GGTCGAGCAGGGGCTCCCGCTAGAGGGGGGTGACATCTCGTCCAGCGAGAGCGACTCAAAATCCTCGAGTTCGCACTCGAGGCGGCGAAAGAGGAAGTCG
AAGCGGCGTCGGCTGAAACCTCGCCTAGAGCCCGTACCAAGTGACAGCTCACCGACGGAGTCGGTCTGCGTGCTTGAGTATGTGGAAGGTACCTCTGGCC
GCCGACGAGCACTCGAGCTTGCAAACCCGCCTGGCGAGGCAGGGTCGATCACTCGACTTCCAGGTCTCTCCTGGAAGAACTTCCTTCGCGGCCTCAAGGA
CGATGAAATCGAACAGGTTTGCCTGATCACCGACGCCGATTCGGCGTCGCTCGAAGTGAATGCAGTCAGTGACGGCGACGCTCCCTCGCGCCCAAAGAGC
GCTGAGCCGAAGTCGGCCCGCGAGGAGCGCTTCGCAGCGCAGTCTTGGGACGCGCTACGCGAATCCGGCAATCCAGTCTACGAGACCGCCCGCGAATATG
AAGATGTATTTCCGGATAAGATCCCAGCTGAGTTGCCAGCTGACCGAGGAATTCGCCACGAGATCGATCTCGTGCCCGGCTCGAAGTATTGTGTGACGCG
GCAGTGGCCGCTCCCGCGAGATCAGGTCCAAGCTATCGATGACTTCTTCGAGAGCCGCCGCAAGGCGGGTCATGTGCGTGAGAGCACATCGCCGCACTCC
AGTTCGACCTTCTGTGTGAAGAAAGCCACGGGCGGATGGCGCATCGTCCATGCCTTCAACAAGCTGAACGACGTTACCATCTCTGCCCAGACGCCGATTC
CTCGGAAGGACATGGTGCTCGACGCAATGTCAGGTAGTGAGGTCTTCAGCGCCATCGACTTGACCGATGGGTTTTACCAAATCCTCATGAGGCTGAGCGA
TATACCGCTCACCGCGGTAAGCACTCCAAGTGGTATGCTCTGGGAGTGGCTTGTTATGCCGCAAGGGTTGAAGAATGCTCCCGCCACACTCAATCGCATG
GTATCTCATGTGATGCGCCCGCTCCGCGATTTCGCACCGAGTTATTTCGATGACATCTTCGTACACAGTCGCGCTGAGGGAGGCCTCAGCGCGCTTGAAG
TCCACTTGAAGCATCTGAGGCAAGTCTTCCAAGTGATGCGCAAAAACAAGCTGTATGCCAACTTGAAGAAGTGTATATTCTGCGCGCCGGAGATTCCGGT
GCTTGGCTGCTTTGTGAGCAAGAACGGCGTCCGCGCCGACCCCGAGAAAGTGTCGTCGATATGTGCGTGGCCTACGCCACAGAATCCCACTGAACTGCGT
CAGTGGCTGGGTCTCGCAAATTATCTCCACAAGTATACGAAGAATTACGCCGGATTGATCCAGCCGCTCTCTTCTTTGTTGAAGAAAGATGTGTCGTGGT
CGTGGACTTCCGCACATCAAGCCGCCTTCGACTCGGTGAAGAAGATTCTCGCCGAGGCCCCAATCCTCGCGCTCCCGGATGACTCGAAGCCTTTTCACGT
CGTCTGCGACGCGAGCGATTTTGCCATCGGCTGTGCGCTGATGCAATTCGATGAAGAAGATCGAGAGCGTGTCGTAAGCTGCCAGTCTAGGCAGATGAAG
CCGGCGGAGCGCAGCTACCCTGTTCACGACAAGGAGCTCCTTGCGATATGCTACGCTCTGATCAAGTTCAGAGTGTACTTGTTGGGTGAGGATACCTTCG
CGGTGTACACCGATCACGCATCGCTGAGGACAGCGATGAAGGGTCCTCATCTCTCCCAGCGGATGGCCCGCTGGCTTTCGTTCTTCTCTGAGTACAACTT
CGTTGTCCACTACAAACCCGGCAAGAACAGCATTCTCGCCGACGCTTTGTCTTGGCGTCCCGACTACGACCCACGCGGTGCATTGGGTCGACAAGCTTCG
CTGGATGAAGACGATGTAGACGAGTGTGCCACGTGCGAGGCGTCAGGCGTCAACCTGACGAGCGTCTCCCCGGTAATGCCACTTCGCGACGAGATCCGAG
CTGCTTACGAACATGACTCGACGTGCTCCCGTATCCTGAAGCATCTCCGCTCTACCAGCGCCGACACACTGGTAGCCCTTTCCCGCTCTGTACGAAACAA
AATCCACCGATATCGTCTCGAGGACGAGCTGCTGGCGTACAGCATCGACAACTTCGATGCCCCACGTGTCGTTGTCCCTAACGACCCCGATCTGCGCTCA
CGGATTATCCATGAGTTTCATGATGCCCCGCTGGGCGCTCATCTCGGTCGCGAGAAGACATTTGCCGCTGTGTCACGCGACTTTTATCGGCCACACCTGT
ACAAATGGGTGCGTAAGTGGGTGCGCACCTGCGAGACCTGCCAGCGCGTGAAACCTGCCGCGTCTTCGCAGGCTCCCTTGCGCCCTCTACCAGTGGCCAC
CGAGGCCTGGCGCTCGGTGTCGATGGACTTCATCTTCGGGCTCCCACCCGATGCTAAAGGACGATCAGGTGTCTTGGTATTCGTAGACCGCTTCAGCAAG
ATGGTTCACCTGATTCCGGTGTCGGATGCGATCACCGCGGCAGATACCGCGGTGCACTTCCTCGATGCTGTCTTCCGTCATCATGGCCTTCCCGAATATA
TCGTCTCCGACCGCGACCCGCGCTTCACGTCGGCCTTCTGGTCAAAGCTCTTCGAGCTACTGGGCTCGAAGCTAATGATGTCCACAGCAGCCCATCCGGA
AACGGACGGCCAGACGGAGCGCGTAAATCGCGTCCTCGAAGACGTCCTTCGAAGCTACGCGACGTCGTTCTCCAGCTGGAGCTCGTTTCTGCCACTGGCC
GAGTTCGCTCTGAACAACGCGGTACACGAGTCGACTGGGCTGACGCCCTTCTTCGTTAATAACGCGCGACACCCGCGTGTCTCACTCTGGGTGAGGAAGA
AGCTGCCGACAAGCCGTCTACTCCATCTGCGATGTCTCCGGCGGCTACACCGGTACTGGGTCAACCGGTACATACACCGGTTGCTAATGATATCTCGAGT
GTATCCCCTGTTCCCACGTCGGTCAACGCAGTGACACGCTCCGCATCGAGCTCACTTGCGCCAGCTAACTACGCGCCGAAGCATGCGGCGCGACCAATCG
ACTCCGCAGTCGTCTCCGACTTCGTAGTACAGCGCCAAGCGGTCACCCGCTATGTTCGAGACGCACTGCAGGATGCAGTGGACAAGCAGAAGGAGAACGC
TGATAGGATCGGCCGCAAGAACACGGCCACGTTTACGACAGGCGAACGCGTGCTCCTGTCGACTGAAGGTATCAGAAACTCTGCGGTTACCAACCTCGGC
GCGAACAAACTCGCGCCGCGCTTTATTGGGCCATTTACGGTAATCAAAGCCATTGGTGATGCCTACACGCTTGACATTCCTACGTCACTACGTCTGCATC
CGACGTTTTACGTCGGACGGCTCAAGAAGTATCACCCCGCTACGATTCCAGAGTC