Description :
From Genome Similarity Track
Location :
Scaffold_2534:50- 3631
Transcript NameFunction/comments
Phyta_totarag14593hypothetical protein
Phyta_totarag14594hypothetical protein PHYSODRAFT_335121

Sequence
3581 bases(100 bases per row)
GAATTGGTGAGAACGTGTATACGACAGAAGGAAGAACTCGGATCAAGGTCACCCTAGCTGGATCGCTGGTATATTTCTTCGATATCTCGGTGGGCGATCT
atctggccaagaagccaTCCTAggcatggacttcatggttCCTGTGGGGATCAGACTGGATCTGGCTGACGGGTCGATCCGCCAACCTGACGAGGTAGAG
ATCCGACTCAGCGGGCGCCGACAGCTCTATACTGACAAGGCGAGGATCGTGAGACTGGATCAGTATATGCAGATCGAGATCGGAGAGTTGGTGGAGCTCC
CGCTGCGCCTGCGAACGTCGGAGCATGATATGTTATGGGTCACACGTGGTGAGCGCTGGGTACTGACGGTTACTAAAGGACCTGGATGAGTACGACATCT
GCAGATCGCCAACGTGGACGAAAAGCAATTGATTTTGCAGGGCGATGAGAGGATTGGGATCTGGCTAGCCAGCGACCgtgttcctcgtcttccaggATTC
GTGTCGATCGGATCTCGTCACTACATGGAGTGGCAGAATCTCGCTTTCCAGGCTACCGCCAACGGGCGATCTGGATCCGCTAGTTCACCTGACTTGAAGT
GTAGATCGGATGCCCCGCCGTCCGATCGGGTTATCACTGGTGGCGAAGGGCCGAGATCGATGGAGGTAGAGAGGGTCGAATCAGATCTAGCGAGTCTGGA
ACCGGAGGACTCCCTCCAAGTCAGCTCGAGCGGGGTCCAAACTGCCATGAAAGCTTACGATGTAGATCGAGGTGAGAATTGGCCCATTGATGATGTGTCG
AAGATGGATCGAACCGGAATGCAGGATGGAGGGGCGACAGTCGAGGAGGTCGGTGATTACCCCCTGCCAGACAATCAGACTGTCGGAACTTCAATCACTG
GGGACAGACTGTCTGGTTTGGGACTTGTAAGATGCTCCGCAACGAGATCTACCCTCGGAATCCAAGGAGGGACCAAGATCAGCCAGGATTGCGATAGTTG
AGGCAGATCCGGCGTCGGATCCAGCGTCGGATCCAGCGTCGGATCCAGCGTCGAGCGCGTCGACGCAGGAGGTTACTTTACGGATAGCGGAGATCGGGCA
TAGCCCGACCTCGCAAAGCCACGAGCCACACTGGATCCAGAAAACCGAAGCAGATCCGAGGCGGAAGATAAGAAGCCCGATCTACCGTCGACAGTGAtcc
gaggcgctggagcgtCGAGGGATACGGATCGCAAAAAGAACTTGGAGTCTATCAATGATGACCGGATCCACTACCATGAGGGTGGTGGGCTGATGGCGGA
AGACATCGAAGGCGAGTTGGCAGTGCTTCCGGAAGTTCTCATCTCCACAACAGACGAGGTGACGATCGAAGATATCAAGGTAGGCGATCTGGCGTTTAAT
ACCCCGGAGGAGATCGATCTACTACGTAAGATGATCCGGCGGAGAAAACACCTCTTGATCGGCAAGGCCAATGCACTGCCACAGGCAGCCCGATATGTTA
TGTGCGACATCGATGCCGGCGACGCAAGGCCGATCGCGCAGCGAGTGCAGAAAGTGGTACCACGATTCCGAGAGAAGGTGTCAGATCTGATCAAGGGGTT
ATTATCGGCCAAGATCATCAACCACTCGACGCCCCCATGGGCGTCACCGATCGTGGTgaccatcaagaagaacggtgTGGATAAATGATTATGTATTGAC
TAACGGTCTAACTCGGCTGATGGTCTACCCGATGCCACTGATCAACGATCTACTCGAGGATCTGGACAAGGTAACGTGGTACTACTCTCTGGATATGGCA
AGCGGGTTTTGGGTGGTGTCGATGACCGATCGATCTCGATCGATCTCGGCGTTCATTATTCCGTTCGGCCTGTTCCAGTGGAATCGAATCTCATTCGGCC
TCAAGAACGCACCCCAGATTTACCAACGGCTCCTGGATAATGCACTGTATGGATTTATGCGGATCCCGCGATCAAAGCATTCTAAAGGTATCGTGGATCT
GTTTGAGGCTGGAGAACTGGGGGATCCGGGGCGCCCATCGGTGTTAGGACGCAGACCctacatcgacgacatcctAGTGACAGCCGGATCCTGGGATCAG
CTATGTAATCGGGTGGAAGATCTCTGGAAGCGTGCGATAAGTGGAACCTGTTGATCAGCGTGGCAAAGGGCTTCTGGGGGCTACGCAAGGTGGACTGTCT
AGGACATCGGGTGTCAAGTGACGGTCTAGAGGCCAACTCCAAGGATCTGTCGGCATTAACGGACCTGCCTTTCCCCGGATCACTCAGATCGATGCAGTCT
TTTCTGGGAGCTTAAATTATTACGGCCACTTCATAGAAGACTACGCGATCTGCGCGGCGATCCTTACGAGTTGCGGGAGATGGACTTCGCCGAGATGAGA
ACACGTTTTGATCTGCATCAGATTTTGGGGAAGCTAGATCAGGAGCCACCCGATCCAGCATTGCCAGGACTGGGGGCGCTGGATCCAGGTCAACCAGACC
TCGACGTCGCGGACGAACGGTGGTTCCGAGCTCATAAGGCTTTCACAaggttgaagaagaaggttgagACAACACCGACTCTGCGTCACTTCGATCCAGA
TCGATTACCAGTGGTGATCGTGTATGCCAGTGACTGGGCGATCTCGGCTGCTCTGGTGCAAGAGCACGATCGGATTTACTGTCCTGTTACCTTCGCCGGT
CGGACGCTCAAATCAAACGAGTTGAACTACaatgtggtggagaaggaagcgTTAGCGTTGCTGCGGATCCTAGATTTCAACTACAATATGCTAGTGGGGT
TCTAGATCCCTATCCTTACTCGGCACTCAACTCTGGCATGGCAATACAGATCGTCGGGTGTCCAGGGCTGATTAGGTCAGTGGGCAGCTCTTCTGTCACC
TTGGACCCTCGAGATCATGAAGTGCACGAAAGGAGACGACAAGATCCTGGGGGTGATCGCCGCCAGTATTACGCCTAGATCCAAGGTAGACGAGGCTTTG
ATCGCGATCGCACCGAAAAAGGAGCCTCGACGTCAGATCCAGGTGCCGGTCCCGACAGTGAAGACTGATGAAGCGGTGTTGGCGGTGAGCTTCGCTGGAT
CCGCCCGCGCCAAGCGAGCAGGAGGCGCGTTCGGCACGATCCTATGGAAATTACCTGAGTGGAGTGTGGTGAAGGCCAGATCTGGCTCTAACAGTCAATG
AAGCGGAGTATCATGGCTTACGGCTATGTTTCAAACTGCTGGAAGGCCTGGATCTGGGGCGCCTAGGGATCTGTGGCGACTCTAACCTAGTGATTAGGCA
AGTGAGAGGAGAGATCGAATACAACGCACACGGACTGATGTTATTAAAGCAGAAGACTTTAGATCTGCTGCGGATCTGGCCAGATCACGAGCTACAACAT
GTTAAACGTGCCTGGAATGGTAGAGCGGATAGCCTGACGAGCGCAGCGCTCCAACGTCAGGGAGAGCTTGACGTTGAGAGTGAAGCAGATCATCAAGACC
TGATCACGTTGAATCGACTCGACGAAATTCTGGTAGTCGGATCCAATGATCCAGTCGCCCGGATCTCGCCAGTGGCTACTC