Description :
From Genome Similarity Track
Location :
Scaffold_2022:50- 1710
Transcript NameFunction/comments
Phymu_g13824reverse transcriptase

Sequence
1660 bases(100 bases per row)
CTTCCATCAAAAGGGCATACGATTCCACTCGAACAGGCCAAACGGAGTGATGAACGCTGAGATTGCGCGTGCACGTTCCGTCATTGACACAACCCAGAAT
CCACTTGCCATATCGAGCGAGCAGTACCAAAGAACCTTGTCGAGATCTTTCAGTAGGTCGTTGATCAGGGGCATTGGGTTGATCATCAGCCTTGTGAGGC
TGTTCACTAGCCGGTAATCGATCCACAACCTGATATCCACACCGTTCTTCTTAATGATCACCACGATCGGGGATGCCCACGGGGATGTCGAAGGTCGGAT
GATCTTGGCTGCCAAGAGGCCCTTGATCAGATCTGACACTTTCTCGCGGAATTGAGGCGCCACCTTACGCACTCGTTGCGCGATCGGTCTCGCATTCCCG
ACATCGATATCACAAATAACTCCTCTGGCTGCCGACGGTAGTGCATTTCCTTTGCCGATCAAGAGATGTCGTTTCTTCCAGATGATCTGTCGGAGTTTTA
CGATCTCCTGTGGGGTAGCGGATTCTGGATCACCTACCGCAGATCTTCGATCTTGACCTCTTCAGTAGTTGAGATCGAGATTTCTGGGACTACGGCGAGG
TTATCTGCGAGGTCTTCAGCTGAGAGATCACCACTTTCGTGGCAATAGACTTGATCGTCGTTTTTTATCTCCTGGGAAGAGGTCGATTCCGAATCTTTCT
CTGGTGGATCTTCCTGTTTGACCTCTTCCTTCACTTGGATTGCAGTCTCGGAGGTTACTGCGGTATCGTCGGCGAGAGAAACAGGCGTGATTCCGGTTCG
AGAGCCTGGATCGCTCGTTTTTGTCTCAATTGTTCCTTCCTGATTTCGACCCCGGGCCTGATCTGGCGTGCTCTCACGTATACCTCCGCCCCCAGCATCG
CCACTGAAGGTCCCGTCTGGATCGACTTCGGGTCCTGTTGTAGGTGCATTACCTCCGTTCGGACTGAGGAACGCAACTTGGATCTTGCCCCTACCGGCTG
ACTGCGTCCATGATAGGTCCTCCAGGCTCGATATTTCGGGGTGTTCGTGGTCGATCCCGTCGGTTTTGCTCCGACGGAGTATCGATCTCGGTGTAGTATA
CGTCGGGCGTTCTACAAGTGGCTCCGCGGTCCCTCAGGAGGCTCTGATCGAGCCTCAACCGTAGCTTCCAGAGCTAGATTCTGCCACTCCATATAGCGAC
GGGACCCCACTGACACGAAGCCCGGCGATCTGGGTACTTTCTCTCGATCTAGCACCATTCCGACGTGGAGTCGATGATGTAACCTTAAGATCTTCTCACC
CAGGTTCGTGATCACCAGATATCGGGTCCGTCCTATGCCGTTCACCACCGTTGGAACCCACTGTTCCCCCCTGGTCACCCAGAGTTTCTCCGTAGCTGAC
AACCTCACCTTGGCGCCTGTCTCCGTTGATTCTCCGACTGGGATCTGaacatcttcttcgagagcGATCGATCTTACCTTATCCCCGTACAGTCTTTTGC
GACCATTAAGTGGAATACCGATCTCGTCGGGTAGACACATCGATCCCTTGGCGAGATCCATCCGGACCCCGGCAGGGATCATGAAATCCATACCTAGGAT
CGCATCCTGGCCAGAGAGATCGCCGACCCAGATGTCGAAAAAGTAAACCAGATATCCTGC