Description :
From Genome Similarity Track
Location :
Scaffold_241:50- 1450
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_241-snap-gene-0.14Amino acid transporter

Sequence
1400 bases(100 bases per row)
GGCGTCAAGCCCTACGGGCCGGCGATCACGCTGGCCATGACGCTCAACTATGTCATCGGCACGGGCTGCTTTGGGCTGCCGTACGCGTTCATGGAGGCCG
GCATCGTGCTCACGTCGACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCACGATGAACTACACGCTCGAATCCCTCGCGCGTGCCG
AGGGAGTGTGCGCGGCGACCCGTGGAGGCGCACCATTGCACCACTTGACGTACCGCAAGTTCGATTTCGCGACGATTGGAGACATGTTTGCGGGAAAGTT
CGGCAAGATCACGGTGCAGATCGTGATCGCGTTGTACTGCATTGGTGCGCTGTGGAGTTACGCGTCCGTGTTTGCGTCGTCCGTGGCGTCGCTGTTCTTC
AGCTATGTGTTGGGCGATTCCTGTGACGCGTATGGGATTAGCCCGTCGATGGGGTGTTTGGAAGCGTACTATGTCAGCATGGCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGATCGTGATCTCGATGGTGCTGCTCAATATCTCAGACCAGGCGTCGATTCAGAAATTTCTCTCGGTGTACCGAATTGCTGCGTTGGTG
CTGATGCTCGTGACGATGCTGATCAAGATTGGTGTTGACGGCAGTGGTGCGCTTGGTGACCGATACAACCGCATTGGCGCGTTCAACTGGAGCAACTTTG
GCAAGGGTTTTGGGCCGACGCTGTTAGCGCTCAACTGTCAGTACAACATGCCGGACGCGTTGCAACCGCTGAATCCAAAATCGTATGCGCGTAAAGTGGC
GTTTGGTGCCCTTATCATTTCGGGATCGTTCTATTTGCTGGTCGGGCTGCTTGGTGCGCTCGCGTTCGACAACATCAACCCGTTGGCGTCATTGATGTGG
AGCACGTACACCGGCTGTGGTAACGGATGGGATGACTGTGGGTCCACGAACCCATTCGGCGTCTTCGTGCAGCTCGTGATTCTGATTTTCCCCGTCGTGA
ACGTCACGTCCGCATACCCTATGGTGGGCGTCACTGTCGGGGACAACATGCTCATGTCGATTCCCAAGGCGGTCACGGATGCGCTTGGTCCATCGGTGAC
GCGAAGTTTGTGCCGATTGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTCGTGCTCGCAGTGGTGTTCAAGAAACTGGATTTCATCTTCTCGGTC
GCGGGGCTTTTTGGCTTTTTGTTGGGGTTGTCGATCCCGTGCTGGTTCCAGGTCATCGGCAGTCGCTACTGCAAGCGCGTGTGGGGCTTCTCGGGTGCAG
CAATCACGCCTTTCACTGAGCCAATTATCAGTACCGTGAGCTTCGCTGGCACGTTCCTCGCCATTACGTTTGTGATCACGGGCGTCGCCATCTCGACGCT