Description :
From Genome Similarity Track
Location :
Scaffold_2001:50- 1167
Sequence
1117 bases(100 bases per row)
TTCTTGCGGAGCGAGCACCAGATAGACTCACGTGGGTCTAGCGCTGTCCTGAAGCACCTGCAAAGCCTGCACAACAGAGGAGCTCTCATCAACACCTtca
tccagcgtcaccagcgaCTTCTTCAGGCGGCTGCTATTCACGACCCGGCTCCTGGCTTCACACAAGACGTTCTCGAAGTAGTTAGCAATTAAGTAAGAAT
AGCAAAGAGATTGAATAACGATGGCCCGATTCGAACAGGCGCCCCAGAGCCAAAGGTCCGTGCGGTAGCGTCGAAAAAAGAGAGAGTGAGAGCTGATCTT
TGCGAGCGGCAACCGCTCAACTGAGAGCAAGAGGTGGCACGCTCTTAATGGATAGACAGCCAATACGAGTGCTTTGAAATGACTGGTTATCGGCAAATTT
TCAACTATCCGGACAAATTATCCGGACGACTGCAAAACTCTCGCATCATNGGCTCTTAAGCCGAATTTGCGTTGTTTTTAGTTTTTGCATTTTTCTCAGC
TCACAGGCCGTTTCAGGCCATTTCCTCCCGCCTATAAACTTGGCAGCTGCAGGCTGTTTTTGTAGGCACATCCCACTTTTCGTCCCCTAAACATTTTTAC
ATCGGCTACACATAAAATTTTGTGGCAAACGTAATGTATCAAGATTTAGGTACCGGTACTGGTCACACAAGTCCCTTGGTCCGATAAATTATGGTATGGC
TGAATATCATTAAGCTGCCGACACACCAAATTTATCTTGATTGTTGTATGGGACTACAATCACATTATTTGAGCATTGACCAGTCAGAGTGCAGTTTCCA
CAGAGCTGTCCAATCAACAAACTTAGGGTTTGGTTTAGTCAATACCGACGCTGTGCCGACGCATAATGTCGGCAGGCACCGTGGGATATGTATTTGAGGC
ATACGAACCACTAGTTTAGCACGTATCACTTTCATATCCGCAGAAAAACCTACAAAAGACTTGCTGAAACAATGGGCCTCCAAGATCTCGCTCCTGCCAA
CTCACAAAGAGCTCTGAAGACTGCAATCAACGCGTTTGAGCGCTTTCTTACGTCAGAAGATGTTAACCTGGGCTTTATCACCGGATGCCTACACAATGAC
ACGGAAGGATCAACGTT