Description :
From Genome Similarity Track
Location :
Scaffold_159:5- 6498
Sequence
6493 bases(100 bases per row)
AAACCCAGCAAGGAGTCCGTTGTACTTCGCTTCATTGACGGTGAAGCCTCCGCGTAAATGAATCTGTCCCTTACCACTTCCCATCCGGGCCGTTTCCACA
GAATTGCGCTGTATGCTCCTCCTCCGCATCGCACGCGAGCAGATCCATCGAAACTCAGGACGTACTGATCTTCACCCTCTTGTACCGTCGGGATCGGGAT
CTGGATCCGGCGTTTGGGTTCTTTCTTAGGAGCGATCCTAGTCAGTACTTCGTCGATCTTGGCTCTGGGCGTGATGCTCGCGGCCAAACCTCCCAGGATC
TCGTCTTCTCCTTTCGAACATTTTACGATCTCCAGTGTCCATGGTGAAAGTAGGGCTGCCCATTGTCCCAACGGTCCTTGCATACCGGCCGACTTGAACA
ACCAGGCGAGCGTGGAATGTCGAGTCAAGATCCGGATAGATCTCCCCACCAGCCGGTTATAATTGAGATCCAACACCCGCAGGAGTGCGAGTATTTCTTT
CTCCACCGCTCCGTAATTCAGCGCGTTCGGCTTTAGCGCTCGGCTGACGAAGGTGACCGGATGGCAGGTCCCCTCATGTTCTTGTACTAATGCTGCCGAG
ACCGCCCAATCGCTAGCATAGACTTTCACCGTAGGCTGACATCCAGGATCAAAATGGCGGAGGATGGGCGCCGTCGCGATCCTGTTTCTTAGTTCTACGA
ACGCGTGGTGAGCTCGGATCCACCGAGGCTCCACCTTGTCCGAGTTCCCCTCCGTCAACTCCGTCCAGATTGGATCCTCTCCCAAATGGTCACGGGGTAG
ATCCAGTTCCTGTTTCAGGTCGCCTACCGACGTCATGCCATATGAATCCCTTCGTGGATCTGGGACCTCTAGGGCCAGAGGTTGTTGGATCTTGGTCCGG
ACAGCCGAGGTGGCCATCGCAGCAAAATCCACCTTCCTCAATTCATATAGTACCGCAGTAAACAGTGCGTAATCCTCGATGAGCCGACTGTAGTAGTTCA
AACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGGGAAGGGCAAGTCTGCCAACGAAGACAGGTCCTTAGGATTTGCCTCCAACCCCTTCTTGGA
GACTCGATGACCTAAATAATCCACCTTGCGCATCCCCCAATAGCTCTTAACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTC
ACTCTTTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGGTCCCCTGGCT
CCCCCGCTTCGAATGGATCCACTTCTGCGTCACCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATGAG
GCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGA
TCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACACTCATTGATTAGAGGCATCGG
GTATACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAGTCAGTGCACAGTCGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGAGACGCC
CACGGGGACGTTGAGAAGCTGATGATCCTGGCTTGCAGCAGGCCCTTAATCAGATCCGACAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTT
GAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCCTTACCGATCAGCAGATGTCGGCTTTC
CCAGATCTTCTGACGCAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCGGTGGTCAGTGGTACC
TCCGGGATTACCGCCATACCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCGGTTTTTGTCTGATCCACCC
TTGGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGTCACCGGTTGGATTCAGCCG
GTCCTCTAACGAGTCTAAACCCGACAGTTCGGGTTTGACTAGCGTTGCCACTCTCGATAGGGATCCAGGCACTGTATCCAATGGAAAGCTTGGATCCACT
TGTGGATCGGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCGTCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCTCCG
TCATGGATCCCACCTCCATTGCTTGGATCTCAACCCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGT
TGGCTCCGCCAGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGAC
ACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCT
GGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTC
TGACAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAAAGGCCGCCGTCCGCTGAGCTGG
ATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAG
CGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATTCGCGTTCTTCCGTTTGTACGGTATACGCCTTCACCAAT
CCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGT
AGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCATGTTA
GCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCA
TCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGTCTCTCCTCTTTGTAGATCCAGAGTTGAAGAGACTTTGGATCTGGAAAACTCGTCCACTTGGCGC
AAACTAGAGACCCTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAA
ATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCCGGCAACATCCCT
CGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGT
AGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGA
ACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGAGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTC
GCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAGCCGTCGGATCCTGACTCAGTTCCTGAGTCGGGCGCCG
TGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGACCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCG
ATCCACCGCCCGCAGTACTTCTTCAAGCTCGTCTGCGTCAGGAAGTCGTAGCAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTTTCGATGAAA
TGATCCACATGTTCCCGTAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAACGGGG
ATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATTCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTT
GTTCCTGGTTGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCT
CTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAAGTCCGATATAGCTGAGATCC
GTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTC
ATCATGGGAGTTGTCCCCCTCTACTGACTCCATCTCCACGTCCCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGT
TCGGCCAGAAAGCGATTCATCGCAGCTTCAAAGTGCCGTTGCAGGGTGCCCGCGGAAGTGTCGGAAGAGCCTGTGGCGGTCTGGTCCACTGGCGGGACTG
GATCCGTGAGGCGATTACCTCGAGCCTGATCTGACGACTCTCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAAATCACGCGT
AGGGCGTACTGGATCCCGAGCTTTCACGTTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTC
ATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCA
TAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGC
GTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGT
TCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGACGATACACAAACTCGAGAT
CCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTCTTCGTCTTCTTTCT
CGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTCCAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTT
AGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTC
TTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCGGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCG
TGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACGATTGTGGTGTAGCGGGATCAG
CAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACATCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTC
ACCTTGTGTACCCGTCGGTAGGGCGGGGTCTGCTCTCTCGGTAACTTTCGAAGAGTTGAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGG
GTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCT
GGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGG