Description :
From Genome Similarity Track
Location :
Scaffold_146:5- 6204
Sequence
6199 bases(100 bases per row)
GTTGCTTTTGCCTCTCCACCTTAGTGGCCGTGCTAAGAGCTGGGTTTACCCAAGTCGAAGCAACACCCCCTGGATGTTTCACATCCTGGGCTCCGCTGTG
TGAATAGCCCTGAGCCGCGTTCCTCCCGGCAAACTACGAGTACCGCCAGCGTCTGCGCTTCCTCTCGCGTAAACAAGGGAGGCGCGAATTGCCCGAGTAT
GTGACTTAGATATTCCAGCTCACGGCGTCCCTAGTGTGAAACCGACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCG
CACGGCTCAGCTGTTCCGGGTGCAGTCAAACACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACATCCATCGCCAGGCGCGTACGCCGGCC
TCAGCGTGGCCTGGGAGTTCCTTGTCCACTCCCGGTCGAACAAGCCCCAACGGACCAATTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCT
GCTTCGGCTGCGGAAAGATGGGCCACTTCAAGCGCGACTGTCGCGCGAAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCA
GAAGCCAGGATCCCGGGGACAGGGGAACGCCGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCG
CGTACCACGGGGACTTAGCCCCTGAGAGCCTTCGCACTCTCGAATTGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGA
TCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAACTTCGCACGCCGCCAGACGCTTGCTCGTAACAGCAACAAGTTGTCCGATGCTTTGAGA
GAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAGCGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACT
TTGAGAGCCTCGAACAGCTCACTGTTCTCGATATGGATCCATATGATATGATCCTGCGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCAACTGGCG
AGGCAAGGCAATCGGTGCCAGCCGCCTTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGTGCTGA
CAGGGTACCAAAGCATTAGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCAGCGCCCAGACGAGGCGCTGGCC
AAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGCTCCGCAGACAGCTGCAGCTGTCACGATCACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGT
TCCACTCACGGTCGCCCAGACCTTAACTCAAGAGGTCGCCCAGACCTTAACTCAAGCGGAAGACGTCGGATACGCTTCCTGTGTGGGTAGCACAGTGCCA
CACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACCACAATACCACACGAGGCCACGAGTGCCTCGGATGTCG
TAGCGACGACATTCCGAGACGTGGGCAGCAAAGCTCCACGTCACGGTCGCCGTCATCAACGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTTGTTCC
GATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGCTATCACATCTTCGATGGCGAGACCGGTTTA
CCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGACAGAGGTTGCAGAGATACTGATCCTCGAAGAAATGACGGCTGAGGCTTTACTGGCCAACCTCA
AGGCTGGAGAGATTGCTGGGATGGTGCTCATGAGACCTGAGACCACTCGCGAGGAGCTGAACGCCTCCTCTGTCTTGGACGAGGACGTTCTGAAAGAACT
GAACAAGCAGCGTCAGACGCGCTTGAGTTACGAGATCCTTAAGAATTCCAATGCTCCGGTGTATCCTTTTGTGACGGAGTATGCGGACGTGGTGAACAAA
CACCCACCGACCCAACCCCAACCGGATCGAGGCGTACGGCATGAGATTGATCTCGTACCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGC
GTGAACAGTGCGAGGTCAGTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCAAAATCCCCGCACTCGACGCCGACTTTCTGCGT
TCGGAAGCCGAACGGAAAGTGGCGTCTAGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACAAATCCCACGAAAGGATGTGTTG
TTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACAACCCGCTCACCGCGG
TAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGATGTTCAATTGCCTGGTGACGCAATTGTTCCG
CCCTTTGCGTACCTTCGTACAGACGTACGTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCCAGGACACCTC
CGTCGAGTGTTGGACGTGATGTGGGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGGTTTCGGTTGCTTCATAA
GCAACGTGGGCGTTCGAGCTGACGCAGACAAGGCCAATGCCATAGCAGCATGGCCGACGCCCCGATCCCAAAAGGATATTCGAAAGTGGTTGGGCTTGGC
CAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTATGCCCTTGCCGGTCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGATCAC
CAGGATGCTTTTGACAGCATCAAAGCCAGTCTCCCAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCG
ATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAGCTA
CCCTGTCCTCGACAAGGCGCTCCTGGCAATGAAGTATGCCCTTGTGAAGTTTCGGGTTCACCTTCTGTGCTCCCGGCCCTTCGTGGCCTACACAGACCAC
GCATCCTTGAGGACGGCGACAATTCTCCTCACCTCTCCCAACGGATGGCAAGGTGGATGTCCTTCTTCGGGGAGTACGACTTCCGCGTCGAGTACAAGCC
GGGCAAGCTCAAAGTGCATGCGCACGCCCTCTCTCGGCGTCCTGACTACGAGTTAGCCCACATCACACGGGTGACAACGGATATATATGATCGGATACGC
ATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATAGTCAAGCTCCTCACGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCAC
GGCTCCACCGATATGTATTGAAGGATGGCCTCCTCTATTACCGGGTGGAGCCCAATGACCCCCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTT
CGATATTCTCGCGGAGGCGCACGACGCGCCCTCCAGCAGCCACTTCGGGCGCGAGAAGACCTTTCTGTCGGTCTCTCAGGCCTTCTGGTGGACCCACATG
TACCCGTGGGTTGCCCGATACGTTAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCATGCCCGTACCGG
CTGACTGTTGGAAGTCGATGAGTCTCGACTTCATCTTTGGGCTTCCTGCCGATGGACACGACAACCCCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAA
GATGGTAAATCTTGCTCCGGTTCCCGTCAATGCTACGGGCGAACAAACCGCAAGTGGTCCTCGATGGCCTGTTCCGCTATCAAGGTCTCCCGGAGACGAT
TGTCTCGGACCGAGACCCGCGGCTCACGGCTGCGTTTTGGTAAACGCTGTTTCCTTTGCTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAG
ACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACATGGTCGACGCAGCTTCCAGCTG
TTGAGTTTGCGCTCAACAACGCAGTGCACGCGTCAACGGGGCTCACGCCGTTCTACTTGAGCGGCTTCCATCACCCCAGAGTGTGTCTCACCTCTTCGAG
GAGACACGGACTCCTCTATTCTAAGTGGGGGGGAGGCCTGGAAAGCCCTTTCATCCCAGGCCTCGGATGTGAGACCAGTTTTGCTGCGGTAACAAGTGGA
ATCCTTTATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCCATGGCAGCTGCCCAAGATAAACAAAAGGAGTACTCCGACAAACATGGAAGAGGAA
ACTTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAACCTACTTCTTGACACTGTCAGCTGTGTCGGCAGCAACAAGCTGAAGCACCG
CTTCATCGAACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGATGT
CTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGACTCGCAGACCCACCTTGACCCAGCTCCTCGAAGCGAGGGCGGTCACAGACGTCGACGAGGGCGTC
GGAGGCACCCAAGCCTCGGTCGGAACGGCAAGGCTACGGTCAAGACCGTACGCCGGAGGGGCTCCGTACGAACGGACCCCGGCGCCATACGCCGAGTACG
CTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAGCAGAGCCTCAATCCGTCGGATCATGCGAGA
GGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCTCGCTCGAGCCACAGTCTACCCACGAAAATGAACC
TCTCGCTCCAACAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCTCAGCCTGGGCGGCAGCATCACCGCCAGTCCCAAGGCCAACTGCAA
TCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGAGCACTCGGACGAGAGTGGCGTTC
GGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCTCTTCCACGTGAAGCGGATCCTCCAGGAGCA
ACGGCGTCGCGGTAAGCGACAGCTCCTCATGAAGTGGAGGGGTTATGCCCAGTCCGAGAGCTCGTGGGAGCCGATTGAACGGCTCCTAATTGACTGCCCA
AAGGCTGTCGCAATCTGGGAGCAGAAGCGGCGGCAGCTTCATAAGTAGCCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATTCCGTACCC
GCGCTCATCGTGAGCGCTGGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGG
TCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTCAAGAGACTCCACCCATGCCCAGAACATGTCCCCACAAG
AACTCCACGAGGGGCAGTTCTCGGGCATAACCCAGGGATATCCCCAAAGAGGATAGAGACCACCCCGGTCTCGGGTTTCTTACGACAAGTCGTGAAGTCC
TTAAGAGGGACACGATGGGGCGCGAGAAGCACACACCGAGCCGCCTCCAAGCTGTCAACAAACAACCGCTCCTTTTTTGAACAAGGGTACGCTCGAAAAC
ACCCCTAGAAGTGTGGCCGCCAACAAGGCCACGAGGAGCGACCTGAAGCTCCAGGAAGAGGTCAGCCCCAGAGCTATCCTCGGGAGGCCAATACCCTCT