Description :
From Genome Similarity Track
Location :
Scaffold_464:5- 5362
Sequence
5357 bases(100 bases per row)
TCGTTCCACAGACGCTCGCAAGTTCGTACCAGCGTCACAAAATTCTGGTCAGTGCTGGTAGCGACAGTACCAAGAAGAGAAACCGAGATCCAAGGCGATG
GCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAATGCGATACAGGATCGAGCGGATCGACACAACGAAGAC
GCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTGTATTTGGATCGAGTGAAAGAAGGGTACGCTCGCAAATTGGCCCATCTATGGCATGGAC
CGTTCCGGGTGAGAGAGAAGATTGGAGAACATGCGGTGAGGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTGGTACACGTATCCAAGCTGAA
GTTGGTCAAAGAATATCCGGATCGGCCGCAGGTCCGTCTTTCGGTAGATGCATCCGACCGCGTCGACTTCGACGAAGTTCTCCTACCGGAAGACAGTTGG
AATGTGGATCTCGAAGCCGACGAGCTCGAAGTCGAGAAGATCACCGATATGAGATCGGGGAAGCAAACTAGATACGGACGGATTTACCGTGAGTTTCTGG
TGCATTGGCGTGGATATGACGAACCTAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAA
CAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGGGGACCCATGGATGTGAGTTGGTCATATCGATGGGAGGATGAAGAAGGACCCACAGGAA
GGGTGTGGGTCAGGAGGAGGAGGATCGCTGATATGAGTTGGTCACATCGGAAAGAAAGAGAAGACGAATCCACAGGGTGGATTAGGAGGAAGAAGTGAAT
GTTTATGCATAAGAGTGACGTTTTACGTGTGAGGAGTCCTGCTTGATTTCGAGCACGAGCTTTCAAGGGCCCGAACTATACTGACCCGATTGAACCTGGG
TCATTGGCGCTAGATCCGGATGAAATCCAGGCGCAGATCCAACTGGATCCGGGATCTCGCCCAGAATCAGGTGTACGCTGAAAGGGTGGATCCAGCCCAG
ATCCAGGTGTACGCTGAAAGGGTGGATCCAGCCCAGATCCAGGTGTACGCTGAAAGGGTGGATCCAGCCCAGATCCAGGTGTACGCTGAAAGGGTGGATC
CAGCCCAGATCCAGGGGTACACTGAAAGGGTGGATCCAGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCTAGCCCAGATCCAGGTGTACACTGAAAG
GGTGGACTAGATTTCTCAACCGACGAAGGAATGTTGTAAGCATATTCAAGTAAGAAAGTGTGGATTATAATAGCTTATGCAAAAGGCTAGCTCGACCCAG
TATCCAGTCGCTAGTTACTGCTACGAAAGGAATCCACGAAGACGGAAACTGGGGCGTGGTGTCGAAGAGTGATGAGGATCAGGTAGTCTTGGGCTGAACA
TTGAAGAACTTGCCCACTAGACGCTGGATCTGGCGTCCTGGGTGTTGGCTCAGGTCCCCGCGAAACTGGATGCGCCAAGGCTCGGCTTCGTCGATCTCTC
GCAAGGCTTCCAATAGGCTCGTGGGTTCTGGGCGATGGAGGTTGGGATCCTCCAAGTTGGCTTGACGGGATACGGATCCCGGAAACCAAGCTACCTTATC
CCCGCGTCGGGGTAGATGCAAGAAGGATGGATCCAGCAAAATATCCACGTCACACCAACCGTCCTGGATTGCTAACACGAGGATCACAAGGACTCTCTTC
CAAGCTCGGCCCGCATGGCTACGCCGGTTACCACGCTGCTTGTTGAAGTTGGACAACCAAGTCGAACCCTGCAATTGATTCCGAGAGATGGGGAACCGGT
GAGTGCCCTCCCATATAGCAACCCGGTGCTTGGAGGCGAAATCCCGGAACGCCCGAACGAATACCCCGAGTCGCCCACGCACATCACCCCTGAAGCTAAC
CGGATCCACCGGTGTGGTGACCAGCGTATCCCACGGGGCAGCACTTGTCAGTTCCTCCACGAGGGGTCTGGTGATGAGCGAATCCACGTACCCGGCCCTC
GGGATGGCGTCCGCTGTCCGAGGGAATATCCACTCAGCCCGAAAAGGCAACTCCGGAAACAGAACCGTGATCTTCATGGAGATGACCGCGACTCGGTTCA
ATTTCTTGGACGACCAAGCTCGATGTCTCTGGTAGCGAAGGCCACAGGAGCACGTCTACCAGGAATGAAAGCGGCATCCGGACCAAACGGAGCCACGGGG
AGCATCCCTGGCAGTGACGAGTTAGGGGGAGCGGGGATCAAGACGGATCCAGGGGATCCGCCACCGTGAAATGATCCCGGGGATCCGCCACCATGAGGCG
ATCCTGGAGATCTATCACCATGAGGTGACCCCCCTCCACCAGATCCGGGAGATCCACCACCAGGCGACCCCCCTCCACCAGATCCGAGGAGTCCGCCACC
ACGAGGCGACCCTCTCCCACCATCACTACCCGATCCGCCGTCACTGTCGACTTGGATCGCGGATCCTGCAGTGTCGCCTCCGGATCCGGCTGTGCCAGCG
ACTTGTGGAGGCGGCGTCGAGAGGGATCTCCGCCGGGCTTCGGACCGGGATTGGGACAGAGCCTGTCGCGTGTCTTCCTCCAAGGCATCCTCAGCGGCTT
GAGCCTCCTCCGAATCCTCTGGACTCCCGTCGTCATCGTCGTCATCGTCCTCATCGCTCAGAGTGAAGGGATACGGGCCGGAAGACGACGTATGCTTCGA
CGACGATCGGTTAGGAGGCCCTGAGCCGTCAGACCAGTCTGACTCCTCATCCTCGTCGTCCTCCGAGCTGCCAAGTCCACATCCCGGGGGAATAACACGT
TTAGCTTTCCCCTTCCCGGGTCCAGCACGGGCTGGCGGATGGTCGATGGAGGCTGGCCGGGGAACGGCCGGCGTCGTCACCGAAGGACCGGCGGTGGATC
CCGTCTTGGACGTAGATCCCGTTTTGGCCGTCGATCCGGACTTGGACACCGCTGATCCTGTTTTGGATGGGGCAACGGATCCAGTCTTGGACGCCGTAGA
CCCAGTCTTGGGTCCGGATCCAGATTTTGACGTAGCAGCAGTGGATCCAGCCTTGGATCCCACTCCCGCTTTGGACGTAGCGGCAGATCCAGTCTTGGAC
GCCGAGGTAGACTTGGATCTAGCGGTGGATCCAGACTTGGATCCGGCACCCAACTTCGAGGGGGAAGCGGAAGTCTTGGACGCGGGTGTAGATCCCGCCT
TGAACACCGAAGTGGATCCCGCTTGCGGAGCCGATTTAGAAGTGGATCCCGCTTGCGGAGCCGATTTAGAGACCGGAGTCGTTTTGGGCTTGGTTTTCGG
GGAAGCTCGGGCCTGCTTATGGGGACGGGAGGATCCGGTGCTAGGAGCGGGAGATGCACTACGCGGGCGTTTCGCAGCCGACGAATCCGCCCCACTTACA
GTCGGAAGAGGAGCAGAGACGCTAGCAGCCTGAGAGGGCCCCGACAAAGGGGGAAGTGGATCCGAAACGGCAGCTGTCACCAGCGCCAGTCGTCGACGTG
CCAGATCCCGCTCCGACAAGCCACGATCGCGCTCCAGGATCAGCTGTTGCTGCTGAGTTTGGGCTGCGGAGAGTTGATCCTGGAGTTTCGCGGCGGTCGC
ATCTGCTTCCTTCAATTTGTCACCTAGATTGACAATAACAAGTGAATATGGAGCTACTAGCAAAGGCTAAAAGAGGATCCACGTACTCGTGCGGCGAAGC
TTGGATTCCAGCTCCGTTTGCGTACGATTGGCATCCGCCCACTCGGTAGCCGCCTTGTCCCGCTGGAGTTCGCTGTCCGCCAGTTTCGCGCGGATCTCGT
CGCGCAATCGAGTCATACGCACGAATTCTTCAAGCGCGTAATCTCGTCCGGCAGACGCCCTCTCGAGCGACTCCTTGGTGTCTTGCAACTCCTCAGAGAG
TTGAGCCAGGGCTACGTCCGGCGATGAGGGAGGTTGATTTGGCGCGGGGGACCCTCCACGCGCCGACCCTAAGGCGGATCCGCCATGGGTGGATCCCACC
CAGTCGTTGGTCACCACCTCCTCCTGGGTCAGACGCAACTCGTCACGGAGACGGGCCAAGCTCACATCCGCAGCTGCCCTAGCAGTCTGGGAATCCTCCA
GATCCCGCTCGAGGTCGTGGATCCGGGATTGGAGTTGGTGGATCTCAGATCCGGCGAGTGCCATCTCCCTAAGGAGATGGTCGTTGTCATCTCGCATAAC
GTCTCGTTGACGGGAGGCGCGATCCAGCCGTCCGGTCAGGTCGCGGATCTCGACCGCCTGATCAGCCAACAGGAGTCGCAGGTCCTTCGACCGAGAGGCT
GCACGGTGCTCCCATCCCTGGATTTCCATAGCCTGGTCATGGACTTGGGCCCGCAAGATCTGAAGTTGGGTAGCGTGTAGGGACGCAGCTTGGTCTTGGG
CATCTTGAGCCGTCTGGAGCTCCGCCGTCAGGGTTTGCACCTGATCGGAAAGAGCCTGGGCTAGAACCCGCAGATCGGTGGGCGACATAGAAGACGGACT
GACCGGAGGGGTAGTGGATGGGGCCTTGCCCGACGATTTGCCGGTACGCTTGGCGGGAGACATGTGTCGCGAAGGGGAGAAAGCGGTTGTGGATGCTAGT
AATGCACGCCGTGAACGCTGTTGTGCAGCGCCGACAACGTACAGGAGGCGATTGTGGTGAAGTGCTTTTTCAGAAATAAGAGAATGGGCCTGACGCGGGG
TCACTATCCCGAATCAGTGACAATTTCAAGTGATTAGAGAGGATTTGGGTTGGTGGCACGGATGCAAGTTGCCGGTGGTGGATTAGCCATGACGAGCAGC
ACCCCGTATGAAATGACGATGGATCCGATATGAGCGACGTACGAGAAGGCAAGATCCACCAAGACTTACCTCGGATCCACCCTTACCTGGATTAACTAAG
ATGGAAATGGGATATACTATACAAGAGTGGATCGGGTGTGGATCCTATGAAGGAAGGATGGTCGGTGCCCTCTGAAGATGGATCTAGTAGCCATGGCTAA
TGAGGAGTCAAGATCCACCGCGAGGTACCCCATATCCCATACTTCCGAGTTCGGGTCCAAGGAGGGAGGATCCCGCATAGAAGGACCTGGATCCAGGGTA
CAGGGATGAGGGATGCAGTGGATCTAAAACTTTCGTGGGACAATGGAGATCACAGACGGTTGCGAGATGATGTTGGGTGATGGGAGAGCTCAGATCGACG
ACGAGTGCAAACTTCCAGTGAAGTGGATCCAAGCGACCTGGATCCGGATGAGTGTAC