Description :
From Genome Similarity Track
Location :
Scaffold_1257:5- 4723
Sequence
4718 bases(100 bases per row)
TGGTCGATCGAAAGAATGCCATGGTCTCGTCCATTTGGTTTCACCCCAACAGCCGGTAGGTCCAGCAGGATAAGtgttgtgattgcacttcgtcgtctac
tCGACGGGGTCGCTACCGCTGGGCACACGGCATGCGCGTGACGGGCGTGTGCCATGTGGgggctgcagttgaagtgacatgAATGTGCGATCTGATTGGG
CGATCATTTGGGATCGCAGGCTGTGATTGGACggctggcttcaacttgcacgaCATGTGGTGATTTGCATGGTATAATCACGAGCATTGACGAGACCAGC
GTTTCCATACAAACTGCAAGTCTAAGACGACCCTTTCCGTCCCAAAAGAGCCTTTCCGTCTCATTTCTCAGATTAAGTACGAAGATGTAGGAGATGTAGT
GCGACTAGGAGAAAGCTAGGACGTCTAACTCAATGgagctcactttcggatttcaTTCCTTTGAACACTTCACTACAAGCCTCGCCCGCATACTCGCAAT
TAGACCAAACAgcagaccagcagcgccgccgcctccaagaccagcagcaggagagctGGTAGCTGGAGTTGCGCCACCTAACAAAGCACGAAGCTCCTCA
GGCATGCCCTCCATGACTCTCCAGAGACCAAACCAGTGACTTTGCAACCAGTGCTTCTAAAGCAAAAACAACAATCGGATTTGGCAGGGATTAATTTGCC
GAAGTTGCCCAATCCGTCCTGACCAAAAAGCTCAGGACAGCTGGGGTAATAATACTGGTATGTGATTGGCCGAGAAAGTTGCCCTAGTTAACCTGCCCCG
AATGAAACATCCCCTCAGCGGATGTTTCATTCGGGGGCAGGTTAGAGCGAGGAGCTGAGTGGACTGCTCAGTGATGACGGTATTGGTAATGCCCGAGTTT
GTCTCCCGAACCTGCTGTAAGATTTGCTCACAGTATTATGGCGCTCACGTGTAATCAGTTCAGGATACAACACCACACAATATTGGTCTATCGAACATTT
CTGTCATCGCCACTTCTTTCGTCTTTTGTGGGTACTGGAGATATTAATATGACTAAAAGAGGATTCATTGAGGACTCATAGACGCTGTGGTATCATTCAT
GACAACGAAAACCTCATTTACTTGTACCGTGATTCGACTGTTGCCTTCTGACTTATGGAAATCagagaaagagagagagagagaggatcagactgtctat
tGAGTACTTATGACTATTCTTAAGATGTCTGTATGGAAGTTTGTCTGGTCTTCCGCAATGACTGAatcgttctcctcctcgctaCATCATTCTGCTGGCT
CGATACGTGCAACTCAGAGAAGGGCACGTTGACCAAGTCCGGGGTAGATTGGTGCGCGCAGGGAACATTGGACGCCTGGCCGGGAGGCCAGTTACCACTT
CGGCAGTCCCAACGAGCCATCATATCCCCTGGGCACGTCTACGACTGGATTCTCAAAACTCATGGATTGCCGATTGCCAATTTTATGTGGCATCATGTGA
TTACCGGTATCACATCACAGTGATAGGAACTGTATCTTCAAAGCGTCCCTGAATGAGCAGGCCTCCTTTACCTTTAATCTTAGgcacgcgttgctgcgcc
CAACTCGCTGCGTCACATTTTTAGTTTAACCTTACTGTTTGTATTGAGTATCTCACATCGCCCTATAACCTAACCCTCCCGAGGATCGATGTCATCGCGG
CCTTGGGCTTTGCTTCGCAAAggcagtcgctgcgctcctgcGAGGAAAAGATTCTAAGCTCGGCGCTGagcccgcctccgcaaacACCgcgcggccctgc
ttcgcgggcacCCCGCGCAGGTTTGCAGTGGTTACGAGCGCTCGCAACCGCTCTCCTCCGTTGGTCGTTTTATGTGACTTTCACCCCTCCTTTTCCAGTT
GGGTGCACCACTCACTCTCTTAATCTTATCGATACCCCAtaccctgaacaaaccaaaccacgaaacgctcaagaaattggtttggtcgtaaactacgcgg
gcttgtgaaccaaaattacgtaaaaTATTGGCAGATACACTCAGCATCCAAACCACGGCGAGAGGTTTGGAGCATTTCGGGGACagaggtttggagttac
TTGATAATTGAAACGACTGCCGGCTTTCCTGGCACGATACAACTTGTATTACGAGTCGTCCCGGGTTCAAACCATGAAATGAattcaaacctggtttgaa
CGGTAATTTTGatttggtttgaacggggcctggtttggtttggtttgttttGTTCAGGGCGTGCGATACCCTTGCAGCACCAGGGATGCCTCATGGGAAA
AATCATCTGCAAACAAATTACATTCACCTCGTCCGTAATTTATATTAGATGATAATTTATGTGGAAGTAAAAAACGGCAGGCGTTGATGCGAGGCCCGTT
TAAATCCTCTCAGGGCTATTCGGAAAGTTAAGTAATCTTATCCGGTGAAATCTTGGTGCCATGGTTCCAAGAAAAATAGTGCACCTACTTACGTCCCCTC
CGTTGCATTGCCAACGCAGACTGCTTTGCATTTATGTACTGTTATCACTTTGGCCATCCTTTGAGACGTCATCGGCTGTCTTAAACATCTACAAAAGGTG
AATCACGTCCTACAGCTTATTGGGGGATTCAGCACAAACTTACCGTCATTAGCTTGATGCCGTCGAAATTATGATGTGCTTACGCTGGCAGCTGACAGCC
GTGCGCGCATACTGTGACGGTGAGGCCTCGAAGCCTTCGACGAATGGGCGGCCTTCTGGCAGCATGCTTTACGGTCCGTGCGATCGAGGAATGAGGCGCC
GATGGATGGTCAAGCCCGTGCCATAACGAATTGACTGGTGGTACAGCAGACTGTCTCGTTAAAGAAGTCAATATACGGCTTGACTTCTTTATCGAGACAG
TTTACTGTAATTTATACTGGGATAGCAGTTGCCTGTaaggttgctgctgtccagcCAAATCAGGTTAATTCGCGCCAGTTACTGAAGCCGGTAGCTGAAG
CCGATATTACTGAAGCCCGGATGCAGTAACTGAAGTCGCAGACGGACAGTGCGGCCAGCAATTACTGATACTCTTTGATAGGATCCgctatcccagcctt
cgcgtagccctagtttCTGGAGAAAGTTTTCTCGATCCCGTAACAAATACCACCGTCATTATCTTACTCCTACACAGCCCTGATAGATGCTCAATACATA
GCCCAGGTGAGGCGGGATCTTGGCACAcagcgcagctcgtggagcagatgcTTGCAAGTCACCTTTAGGACAGCTCGGAGGCATGGCTGAATGAACCACG
ACGACCAAAGCGTTCTCGAAGCCATTCGACTTCTGCGGAGGCGACGCATGTGCTGGAAATGCCTGCCGCTTCGCTACAGAGCGGGTTGATTCTGCCGGCG
GTCCGAGTAGCTTCGCGTGGTTCTTGCAGCAACCACGTATCTGGACGTACTTGTGGCAGCCCGGTGCGCGGCAGTAGCGACCACCGCCGTGCGAAAGACA
GAGACCCTTCCACTGGGCGAGTTTAGAGCAACCGTCGAACACGCAGCGACGTCCTCCGCCGTGGGCAACACACAGGCCTCGACTCTGCACTaacttgctg
cagttcgGACTACGGCAGCGCACGCCACCTCCGTGCGCCTTGCATAACTTGCGGGTCTGCGCTTGCTTGGTGCATTCAGGAACGATGCATCGTGGGACCT
TTTGACGGATCGTAGTTGTTGGCATGACTGAGTGCGAGACTGGAGATCGAGTGGTTTGCGCCTTGGATAGTAAGTGTCAGAGTGACCGGTTACGCTCACG
CTGTAAGACGGAGAGTTCGTACCACACACCGATAACACCAATGGTGTTACACCATGGAGCACAGCTCAGCATACAATGTATGATTGTGTGGAACTGCACC
GGCTGTCCTATCCGGGATCCGCTCTTTCCTCAAAGGTGCCTGGTGAGGCGTGCCTGTGTAGATTTCTTCTCCCTTACCCGGCACAAAAGCAACCTCTTAT
GATAGTtgagtacatgtagacaCCGTCAAGGGAAGCAGTAGAGCACGCACTTCTATCATATCTGTCCGAATCTTAGCTGCTGGACAGGTTATCATCTACG
TTATGGGGCGACAGGATCGCCAGTGGTATTATAATAGCTGACGTGTGGTTTTTCGTCAACCTACGTATCTTGGTGGTGAGTTTAGCGGCGCTAGCTGCTA
TAATACCGGCAGGGTTCTGCGTTGCCGCCAGCTGAAGGTCATACGTCGCCGAGTTGTGCTGGGTGAAACTAAGGAGGGCCATTTCCGAGGATTTGTCCGG
AGGGCCATTACACTATGTTAGTACAATCGGGGCAGCCGTTTTCTTACATAACGAAACCTAAGTCAGTGCCCATCCCATCGAGGGTGTCTGTCTGCAGAGG
ATGTAAGTTGAGCGCTATCTTATAATATAAGTAGTAAAACCGCCTTTGAGACCtaccgctggagatgctcttagGCCGCCTATCGACCTCACCAAACACA
ACAGTCTCACTTTCGAAAacgacacagcagcagcacttcacCAGCAACACTCACACAGTTTCCCTCTTGAAAGGTTCCATAAacacttcagcagcacccT
CCTAAAACAACAGCAGTACTCCTCAGCAGAATATTCTAGCAGAGCAGCACTCCACTAGCCCACCTacacgccagcagctcagcagcagaaccaCTACTCC
ACCCCCAGCAGACCAACC