Description :
From Genome Similarity Track
Location :
Scaffold_1539:5- 4368
Sequence
4363 bases(100 bases per row)
CCGGCCGGAGTGAGGTTGGATCTAGCGGATGGGTACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTACGGAGCGAAG
ATGAGGATCATAAGGGCGAATAAGACGACCTGGATCGAGCCCGGAGAAACCTGGGAACTGCCAGATCGGTTGATGCGGGTGGAACATGAGAAACTGTGGG
TTACTCGGGGCGAGAAATGGGTACCTACCGTAATCCAGGGGCCAGGTCGATCACAATACCTCCAGGTCACGAATGTCAGCGATAAGAGACTATTACTGGA
TCATTATGAGGAGATCGGGCGATGGTTAGCGAAGGACGGTATCCCTAGGCAACCTGGATATGTGTCAGCGGGATCCCGCCGCTACAAAGAATGGCAGAAT
CTGGTGTACGAGGCGACTACCGAGATCGAATCCCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTC
CGCGAAAGATCCTGCAGAGGGATCGACGGGTCGAGATCCAAGCAATGGAGGTTGGATCCACGACGGGGGACGATCCCCAGAGTCGGCCCTGAGATAACGC
AGGGTCGGTGGATGAAGGATTGCAGAGGGTTAAAGCCGAACAGCCGGATTCCGCTGATCCACAAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGA
TCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTGTTGGTTTCCCTGATACCATAG
TACCTGATTCCCCGAAGACAGACGGACTGCCAGGCGAAAGAAGGCCGCGGTGTTCGGATCCCAATGATGGATCCTACGAAGACGGAAGATGAACAAGGCT
GTTACCATGAAGGCGGGGATCTACACGCCGAGGACCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGA
TATCCAAGTGGATCCAGGGGCGAATGAATCTGCTGAAGTGGATCGTCTGCGTCAGAAACTCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCG
TTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATTGATGTCGGTGACGCGAAACCGATCGCTCAGAGGGTGAGGAAGGAGGCGCCTCAGTTCCGAGAAA
AACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCTACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGG
GGTGGATATACGTCTGTGCATAGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATCTG
GATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACCCCGT
TTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCGCTCTATGGATTCACCCGAAT
ACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATTCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGCTAGGA
CGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTATACTAAGTGGAATC
TCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCT
GTCTTCGTTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATACAATCCTTCTTGGGCAGTTTGAACTACAACAGTCGGTTCATCGAGGATTACGCC
CTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAACAAGCTCTGGCCCGGGAAA
TGTCGGATCCACGAAGGAATCCAAGTGGTACGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACGGCGAGAGGATCCAGTCTG
GATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGAATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGAATCGCGACCACGCCT
ATCCTCCGTCACTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGGACATGAGGGGGTCT
GTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCCGAATGAACTGAACCACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATC
TGAATTACAACCTGCTGGTGGGAAGATCCATCCAGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGG
ACAGTGGGCAGCTTTACTCTCGCTTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACAAGATCCTGGGCGTCTTGGCCGCGAGCATCACTCCT
CGAGCTAAGATGGATGAAGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAAACCCCGATCCCGACGGTACAAGTGGATGAGGATC
CGTACGTACTTAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGAGGAGCATACAGCGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGC
CAGTTCCACTTATGCAGAGGGCCTCACCGTCAATGAAGCACGGTATAACGGGCTCCTGCTGGGTTTGGATCTACTAAAGGGACAGGATTCAAAAAGGCTG
GTGATTTGTGGACATTCAAACTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCTAACACTGTTACGGCAGAAAGTGATGATCCA
CCTGCGTGGTTGGATGAATCACGAGTTGGTACACGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGTGCCGCTTTACGGAATCAATGTGGG
GTTGGGGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGGTCCGGGAAAAGGACAGTCCAGGTGA
TGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGGGAGTCCGCATTGAGCGGATCCTCAAAGCACA
GAACGAGGAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGGGTCGGGAGGATACCAAATCCTACAGTATGGTTGCTACG
GATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAAGATCGGGATGGATTGATGAGGCTGGTGATGCCAGAAA
CCTTATGTCCTACATCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGAATTGGTCGGGCCTACCAACGGATCCGAGAATGTTTCCACTGGAGGGGAC
TAATCAAGAGCGTGCAACGGTAAGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATGTCCAAGC
GACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACC
GGGTACGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCGCAAACCATTGCTGAGTCGTACGAGGAGTGTGTCTTCCGAAGATTTGGAGCTAGCGAAATGA
TTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGAGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCA
AGCTAACGGGTCGGCCGAGCGCATGGTGCAGACGATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAA
CGACTCCCCTTCGCGATAAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGG
CCATCTCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCC