Description :
From Genome Similarity Track
Location :
Scaffold_339:5- 4193
Sequence
4188 bases(100 bases per row)
GATCGACGTCGCTTCAAGCAGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACAGGTTT
ACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCGGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTC
AAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGAAAGACA
TGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAA
ACACCCACCGACCCAACTCCCACAGGATCGAGGCGTACGGCACGAGATTGATCTCGTTCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCG
CGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAATCGAAATCCCCGCACTCGACGCCGACTTTCTGCG
TTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAGCAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTT
GTTGAACAACATGGCCGGGAGCGTACTGTACAGTTCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACTGCG
GTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGAGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCC
GCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAATACGGCCATGGAGGTGCATCTAGGACACCT
CCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTC
AGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCAAACGCCCCGATCCCAGAAGGATCCTCGAAAGTGGTCTGGCTTGG
CCAACTACCTTCACAAGTACAGTGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCA
TCAAGGCCAGTCTCCAAGAGACCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCTGTTTAGCATCGTCTGCGACGCCTCCAATTACGCCATCGGGTGTGC
ATTGCTGCAGGCCGACACGGCTGGACATGAGCGCGTCATCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAG
CTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGAACACGCGTCCTTGAGGACGGCGA
CTAACTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGGTCAACGTGCT
TGCGGACGCCCTCTCTAGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGAT
GAGGCTGTCGCGCCTATCGTCGAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGT
TGAAGGAGGGCCTCCTCTATTATCGGGTAGAGCCCACTGATCCTCCACGGGTGGTTGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGC
GCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGG
TACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGA
TGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGGTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCC
AGTTCCCGTCACTGTGACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGAC
CCGCGGTTCACTGCTGCGTTTTGGAAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACA
GAGCGCGTTAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGTCGTAGCTTCCAGTTGTTGAGTTTGCGCTCA
ACAACGCGGTGCACGCGTCCACGGGGTTCACGTCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTGGAGGAGACACTGACTCCTC
TATTCTAAGTGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGAAATCCTTTATGGATACCA
AGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAAGAAACTTAAGTATATT
TGAGGTTGGTGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACCT
TTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGAAGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACT
TTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACC
CAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACG
CCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTC
CAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCTCCC
TGATTCCCGGCCTAGGCGGCAGCATTACCGCCAGTCCCCAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCT
GTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACGCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGA
ATGAAGAAGCCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGA
GAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCT
TCTTGCCCGAACGGGGTACGGACGATGAATACACACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGCCAGCATACG
CTTGCTGATCAAGTCGCCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATACCTCCGTGGGCGAG
TACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAGGAATTCCACGTGGGACAGTTCTCGGGCATAACCCAGGAGTATCCCC