Description :
From Genome Similarity Track
Location :
Scaffold_1524:5- 3935
Sequence
3930 bases(100 bases per row)
GTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCAGGACCTCTTTGCCAGCGTTAAGTCCATCACCGGAGAAAGGT
CGCGCACTTTGGATCCAGTGTCATCGTCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATACGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACC
ACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAAGACAGGAAGCCCCTGTGAACGTGAAGGCTCGGGATCCA
GTAGGCCCTACGCGTGATCTGACACAATCCATCCAGGATCGAGCCAGATCCGGCAAGAAGCCAATGGGATTATCGTCAGATCAGGCTCGAGGTAATCGCC
TCACGGACCCTGTCTCGCCAGTGGACCAGACGACCGCAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGGCACTTCGAAGCTGCGATGAGTCGTTT
CCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAAATGGAGTCAGTGGAGGGAGACAAC
TCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCC
CGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCTGC
CTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGAGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCA
CCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGAATTAAGAGTGTCGGTGGCACGACAATACTACCACGCTCGCCGCAGATC
GGATGAATCCCCGCTAGAATACCTTCATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACAC
GTGGATCATTTCATCGAGACGGTGGGGGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTCCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGAG
CGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAATATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCA
CCAAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGAGTACCGTCGGGTCTGTCTCACTGCATCCAACGAT
CGAACGGCGAAGACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAG
TCAGATGTTCACAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACACCTGGTCTGTGAGAAGTGTGGCAAGAAAGGCCATCCCGGGGATCA
TTGCTTCAACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTCGATCCAGCC
AAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTACGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCAT
TTATGCATTTGTGAGCAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATC
TCTAGTTTGCGCCAAGTGGATGAGTATACCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGAGGAGAGAGGCGCGTGGCTACTGGGAGAAACACCA
ACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTATGGATCTTAGGATGTTGGATCC
ATGGATCTGCTAACAGGAGAGTCCCGTGGGTACTGGAAGTACCATGCCCCGGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAA
AAGCAATCCTACTCCTAAATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCGAGA
TTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTCGGTATGCTGGTTCGATATTTGGGTT
GGAGATCTCGCTGGTCAAACCGCCATCCTCGGGATGGATTTCATTGTACCAGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTGTGTTTCCCTGACG
AGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAGGACAACCTGGATCGAGCCCGGGGAAACCTG
GGAGCTGCCAGATCTGTTAAGGTGGGTGGAATATGAGAAACTGTGGGTCACTCGGGGCGAAAAATGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCA
CAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAAATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGGCGAC
CTGGATATGTGTCAGTGGGATCCCGTCGTTGCAGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGAGTCTCTCAGAGAGGTGGAGCTCCC
GGCGGGTCCAACTGGCCCCTTGGTGGATCGGCCTCCATATCCAACTCCGCGAAAGATCCTGCAGCGAAATCGTCGGATCGAGATCCAAGCAATGGAAGTT
GGATCCAGGACAGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAGCAGCCGGATCCCG
CTGATCCACAAGTGGATCCAAGCTCTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCCGAACTGTCGGGCTTAAACTC
GTTAGAGGACCAACTGGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGAACCCCCGAAGATAGAAGGACTGCCAGGCGAGAGAGGGCCGCGGTGT
TTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGG
TGATCCCGGAGGTACCACTGACCACAGAAGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCA
GAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAA
CCGATCGCTCAGAGGGTGCGGAAGGTGGCACCTCAGTTCCGGGAAAAACTATCGGACCTGATTAAGGGCCTGCTACAAGCCAAGATCATCAGTTTCTCGA
CGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATT
GATGGTGTATCCGATGCCCCTAATCAACGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTT
ACTATGACGGATCGAGCTCGCGCAATATCC