Description :
From Genome Similarity Track
Location :
Scaffold_1833:5- 3628
Sequence
3623 bases(100 bases per row)
CAGGTGCCGAGAAGTGTCTGACTTTTGCAGATCTGCTAGCGGGGCCAGCCAGAAATTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGA
TTTGCTGCGCAGCTTCCAGACCAAGTACTCTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTTGCCGCAGATCGGATGAATCCCCGCTAGAA
TACCTAAATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTACGGGAACATGTGGATCATTTCATCGAGA
CGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGTTACGCCTTCCAGACGCAGATGAACTCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCG
GCAAGTATCGCCAAAAGGCTCCGACGCCCACGGCTCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGACTGAATCAGGATCCGACGGTTCG
GACTCCGACCCTCAAGATTACCGTCGAGTCTGTCTCACTGCGTCCCACGATCGAACGGCGAAGACCGGAGACAACTCGCGATCGGGGGATACCGTACCCG
GGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCCCAGGTCAGGTGTTCGCAGTGCGGAGCCCGGAAGCACACTGAATCTGGATGCTG
GAAACATCTGGTCTGTGAGAAGTGTGGCAAGATAGGTCATCCCGGAGATCATTGCTTCTACGTGTGTCGCGGTGTGGGAGATTCACGACGTCGGCAAGTG
TCCGATGGAAGATTCTTACAACCAGATCCGCCATGGTTTTGATCCAGCCAAGCACAGAGGGATGTTGCCGAGAAGTGACCGAGAAAATGTTAAACTAGGA
CGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAGCAAGACATCGCTAGATCCAGGTAGCAGGACCCTAG
ATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAAC
CCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGTCGATGGTTTGAACCTACCAAGGGTGAGGTCACTGCAGATCCACCT
AAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAG
GAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGTCGAGGTGTCTATACTAGATACCGC
CTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGACTGTGTTGGGATTGGTGAAGGCGTTCACCGTACGAATGGGAGAACGCGGATG
AAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCGG
CCGGAGTGAGGTTGAATCTAGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGGGCGAAGATGAG
GATCATAAGGGCGGATAAGACAGCCTGGATCGAGCCCGGGGAAACCTGGGAGCTGCCAGATAGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACT
CGGGGCGAGAAATGGGTGCCTACCGTAAGGGGCCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGATAAGAGACTATTACTGGACCATTATGA
GGAGATCGGGCGATGGTTAGCGAAGGACGGTATCCCTAGGCGACCTGGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGCGTACGAGGCGACTACCG
AGATCGAATCCCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATTCAACTCCGCGAAAAATCCTGCAGAGGGA
TCGACGGGCTGAGATCCAAGCAATGGAAGTTGGATCCAGGACAGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTG
CAGAGGGCTAAAGCCGAGCAGCCGGATCCCGCTGATTCACAAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACAC
TAGTCAAACCCGAACTGTCGGGCTTAAACTCGTTAGAGGACCAACTGGATCCAACTGGTGGTTTCCCTGATACCGGGGTACCTGAACCCCCGAAGATAGA
AGGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGGATCTA
CACGCCGAGGGTCTGGGAGAAGGAATGGCGGTGATCCCGGAGGTACCACTGACCACAGAAGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGA
ATGAACCGGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAAAGCCGACATCTGCTGATCGGTAAGGGTAATGCGTTACCGCCCGCTGCCCGCGGAGT
CAAATGTGACATCGATGTCGGAGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGGCACCTCAGTTCCGGGAAAAACTATCGGACCTGATTAAGGGC
CTGCTGCAAGCCAAGATCATCAGTTTCTCGACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGAATATACGTCTGTGCATTG
ATTACCGGCTGGCTAAGGGTCTGACTCGATTGATGGTGTATCCGATGCCCCTAATCAACGAGCTGTTGGAAGGTCTGGATAAAGTACTCTGGTACTGTTC
TCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGACCCGG
ATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAACGCCCTCTATGGATTCACCCGAATACCGGATCCCGAAAAGGGTGGAT
CCGGGGAAGATCATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGAGGATCCTGGGACCCCGTCTGTGTTAGGACGCAGATCTTACATCGACGACAT
TCTAATCCCGGCGGAATCGTGGGATCAGTTGTGCGAAAGCGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGATC
TATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGTTAGCCGATTTGTCCT
TCCCACAGTCGTTACGGGCAATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGA
ATTGAGAGAGGTAGATTTTGCTG