Description :
From Genome Similarity Track
Location :
Scaffold_2544:5- 3607
Transcript NameFunction/comments
Phyta_totarag14605hypothetical protein

Sequence
3602 bases(100 bases per row)
CAAGGCGTTCCCCTTCCCAATTAGAAGGTGTCGGCGACGCCAGATGATCTTTATTAGtcgctcgatctcttccgGTGTACTGTCCTCAGGGTTTCCCACC
TGGATATTCTCGATCTTGACTTCTtccgtcgtcgacgtgaTCTCCGGTAATACCGCCATATGACCCTCGAGATCTTCTGCGTAAAGCTCACCTCCTTCTT
TGATGCACACCtgttcgtcttctgcatgtTCTTTAACGTAATCATCGGCGAGATCTTGTTTATTCTCGTCCAGGTCCTGTCCCCTTGCCTCAGGGTTTTC
TCCAATCCCTGCAGGTCGATCTTGAATGCGTTTCTGATTTTCACCCATCTCTGCACCTCAATCTCGGCAATCACTTGAATGCTGACATCTGCAATCTTCT
GCATACATTGCCCTTTCTGCACCCGGAACTGGGCGCTTGGTACACTCATCGATGCTGACTTGTACCTTCCCAGCCGGCGACATGTCCACGTTCCTTCGCG
TTTCTTCCGTCGCTGGGGCGCCTTCTCGCAGAGTCCTTCTGTCGTGTTCTCCGCCATCTCTGCCGTCGCCAACTCCAAGCACTGCCACTTTTAGCGGTAG
CTCCGGCGGTCAGGGCAAGATCGCAGTCGGCGTTCGGTATTGCGGTCGGTCCACGGCAGGCTCCTGTGGCTCCTCAATTTTCTGGTGATTTACGTCAACA
TCCACCGTCGCCTGGTAGGCCAGGCTCTGCCATTCGGCATACCTGCGCGATCCCACCGAGACATATCAAGATAAGCGTGGCACTCGATCTCCGGCCAGCC
ACATTCCGACGTGCATGTTGCGATCTAGCACTAACTTGCGGTCGCTCACGATTGTCAGCTGCAAGTAGCGAGTCTTGCCAGGGCCTGCTATCAGGGTAGG
CACCCATCGATCTCCGCGGGTTACCCACAGCATCCGACTCTCGGCTCGCAGCTTCACATCCGTCGATcctccgacgtcgacgtaTCGATCTTCGTTCAAG
ATCACCGGCTCAAGACGATCCCCATAGAGCGGACGTCTGCCGGACAGTTGGATACGCACTTCATCAGGAAGGCAATTCGTGCCGTCAGCGAGATCGAGGC
GAATTCCAGCGGGGACCATGAAGTCCATACCGAGAATCAAGTCCTGGTCGCCGGTAGGTGGACCCACCCACACGTCGAAGAAGTAGCTCAACGATCCAGC
GAGAGTGATCTTGAGTCTGGTCCGTCCGTCCGCTGTGTACGGGGACTTTCCAACACAGTCACATTCCAGTGTCTGACTTTCGCCAATGTAGCACCCAACC
GTACGAGCAAAGGCGGTGTCAATAATAGACACCTCGGCACCACTGTCAAACAGCATGGTTGCTTTTTCGTTGTTGATCTTCCCCACAGCTTTTGCTTGTT
TGAACTTCTTGTCAGGCACGTGGTACTTCCAGTATCCACGCGATTCTCCTGGCGAAATGTCGAAGGCCATCGTCACACTTGATCTCAAATACTCATCGAT
CTTGTGCAAGCTTGACACAGCAGCGGTAGGTGTTCCATGAAGATCACATGTATTGTCGTTCGGATTCATCAGCTTGCTAACCGTCGACTCCGATTGTTTC
TCGACGTATGCATAGACGCAGTATCTAGAACGCTCGTCTCGTACCGGGTTCAAAACCGGCGAGCATCCTAGTTTAACATCTTCTCGGCCGTCTCCGGCAG
CATGCCTGCGTGCTCGGTGGGGTTGAACCACTGACGGATCAAGTTGTAAAACTCTTCCATCGGGCACTTGCCGGCATCGTGGATTTCCCCGCACGCCTtg
cacacgaagaagcaTCGGTCAGACGGATGCCTCTCTTACCGCACTTCTCGCAGGTCAAGCGTCCCCATCACCCTAGGTCGGTGTGTTTGCGCGATCCGCA
GTGAGAACAGCATTTGGGTGGCGCCCCTTCATCTGGCGATCTTGGGTGGCGATCTTGCCGGCGATCACGAGTCGCATAACTCGAACGCTCACGATCTTGA
TCCGGCGGTACCCGGTCTTGCGGCTCACCACgatctccagtcgctgcCAAGTATACCTTGCGCAATCCGGCTTCGCCGTCGGATCCGCTCAACTCAGCTT
CAGATTCTCTGCTGTTGTCGGCCACATGGATCGCTTGGACAGCTCTAGTGGCCGAGGGGTCGGCTGCACCTGGGGTCTTTGATCTAGATTTAATCGATCC
ATAGACGAATCCGCAGAAGCGTCAGGTGGTCAGCCAGATCGCGGTCATCGAGAGTCTCGATGAAGTGATCGACATGCTCGCGGCGGACTTCCGGGGATCC
ATCTTTGACCTGGAGCCGCGCGCGTGGGCCAGCCACATTGAGACGATGCAAGTACTTCAGAGGTGTCTCATCCAAACGTTTCTTGGCGTGGTAGTACTGT
TTCGCAATAGATACACCACGACCGCAGTACTGCTTctggaagctctggagcAAGTCCTTCCAAGTGCTGCGCGTCGTGCGACTCAGTTGTCAGTGCCAGT
TTCGGGCTGGTCCGGTGAGAAGATCGCCGAAAACCAAGCACTTCTCTTCATCGGGTGCTTGATCTCGGATAAAGGCTGATTTCACCTTGCCGATCTAGGA
CCGGGCGCGATCTTCGTCATCATATTTCCCGGcgagcgtcttcagctcagATATCGCCGATACACGGATGCGAGGCGCAGGCGTCGGTTTTCCGGAAGTC
GCAGTCGAGGCCACTGCTGCACGCGCGGTGGtggcaagatcaagatcgtCGGAATCATACTCCCATGGAGACGAGTGGTGATCTGGCGATCCAACcgact
ccatctccacggcttgatctccagtcggTTTCGCGACACGTGGACGGGGAGTGGACTGTTGTTCCTTCAGGAAACGTCCCATCGCAGCTTAAAAGTACGA
CTCCAGCCTCTCTGGCGAGTGGCGTGTCGGGTTCACTGCCGCGATCTTCGTCTCTTGGACCGAAGTTACTGCTTCGCGCTCAGCTCGGTCAGCTCTATCT
CGCAGCATGGCGACGCCAGATGGTCCCAGCGTCATTCGCGGCGGGACGTCAACGCTGTCGGAGTCTACTTCTTCAGTCGCTGACTCATAGTGCGACGACG
TGCCAGTCTGGTCGTCCGGAGCGACTGTCGGCTGCGATCTCACAATATCCTTGGTGGGTTGGCTGACCGTGCCAACCAGGGGCTTCAGCGTCTCGAAGAG
GGTCTTCAGTGCATGTTCAATCGCGCCAACTTTTAGATCAAAGAGCTCATCAGCTTCGAACACGCCAGCGACGATTCCAGACTCCTtcagcagttggagc
aaCGCCTCCACAGCGTCCAGCTTGCTCGACCCAGTGATCGGTTTCGACACGGGACCCTTGAGATCATCGAGGATCCTTGNGGGGGCTTCGATCTCgcaga
cttcttcttggcacTCGATCTTGGGCCAAGTGGTTTGTTGAATGAAGAACCTCCAGCTTTCGCTGGTGGTCCTTCATCCGTGGGGGTCCTCGGAGGGACC
TGGGGAGGAGGTTGAGGTTTCTCTTCCGAGTCCATTGCCGGACCCTTCTCTGTTCCGTCGGTAGAGCTCCTCCCAGAACTCTGCCGATCCGCGGATCGAT
CT