Description :
From Genome Similarity Track
Location :
Scaffold_1491:5- 3369
Sequence
3364 bases(100 bases per row)
GATCTTATACCGACGACATTTTAATCCCGGCAGAATCGTGGGATCAGTTGTGCGAGAGAGTGACATTCCTACTGGAGGCGTGTACTAAGTGGAATCTCTC
TATCAGTGTGGTAAAGAGCTATTGGGGGATGCACAAGGTGGATTACTTAGGCCATCGAGTTTCTAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCT
TCGTTAGCCGATTTGCCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTGGGCGGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGT
TTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTCGCTGCGAAGACCACTCCAGCTGTCCGGATAAAAATCCAACAAGCTCTGGCCCGGGAGATGTC
GGATCCACGAAGGAATCCAAGTGGTACGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACGGAGAGAGGACTCAAACAGGATA
GAGACGACGGATCAGAACTCGGAAAGGTTGGAACCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCC
TCCGTCATTTCGATCCAGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAGCATGAAGGGATCTGTCA
TCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCACTCCTGCGCGTGTTGGATCTGAAT
TACAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGTTAGCCTGGCTGTTCAAGTCAGCCGGGTTACAAGGACGTTTGGGACAGT
GGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAGTGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGC
TAAGATGGATGAGGCGCTGACTAGGGTCGCCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCTATAC
GTCCTGAGTTTCGATGGATCCGCTCGTGTACGGCGCGGAGGAGGAGCATACAATGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGAGCCAGAT
CCACTTACGCGGAAGGCCTCACCGTCAATGAGGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCGAAAAGGTTGGTGAT
TTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGCGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATTTACCTG
CGCGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTG
AATTGGAGAGAGAGGCCGAGCATCAGGATCCCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGGTCCGGGAAAAGGACAGTCCAGGTGATGGC
CGTCACTAGGTCCAGAGGAAGGATTCGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAAC
GAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATT
ACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCCCCTCTACGAAGAGAGTCAACGAGGATCGGGATGGATTAATGAGACTGGTGATGCCGGAAACCTT
ACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGG
GGACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGAGCAGGCCCACAATCGAAGGGAGGTCACCTGGGAATGTCC
AAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTT
TGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTTCGAAGATTTGGAGCTAGCGAGATGATTAGACA
TGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAAC
GGGTCGGCCGAGCGCATGGTACAGACGATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCC
CCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGACCATTCC
AGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAAAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGGCTG
CGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGA
AAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCTAGAAGATTGGAGAACACGCGGTTAAGCTGGAAACGGCAGGTAC
CGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTCGGTCAAACAATATCCGGATCGGCCGCAGATCTGTCTTTCGGTGGATGGATCCGAT
CGCGTCGACTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGATAGG
GAAAACGAACTAGATACGGACGGGTTTATAGTTAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGATAGACGAGGCAGATCTGAACTGTGG
AACATTACTCTATGATTTCTTGAGGGATCGTACGAACCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAAAGTAGGAAGGGACCCATGGATGTGAG
TTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGG