Description :
From Genome Similarity Track
Location :
Scaffold_1996:5- 3193
Sequence
3188 bases(100 bases per row)
ATATCAGATCCATCGTCATTCCATACGGGGTGCTGCTCGCCATGGCTAATCCACCACAGGCAACTTGCACCCGTGCCAAACAACCCAAATCCTCTATAAT
CACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGACCATTCTCTTATTTCTGAGAAAGCACTTCACCACACAGGTCTCGTACATCCCCCA
TCAGGTACTTCTTTAGTCCCAGGATCCACACTTCCTCGTTCTGTGCTTTGAAGCTCCGCTCAATGCGGACTCTCTTCGCAAATGTTTCCTCGAGGATCTG
GGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACCACCACCACTTCGTCTAGTCGATTCAAC
GTAACGAGATTCTGATGCTCGACCCCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCCGCACTGGCATTCCAATCTC
GCTTGACATGCACCAACCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGTACCTGTCT
GATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCTTCATTG
AGGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTTCACAGTATTGCACTGTACGCCCCGCCTCCGCGTCGTACGC
GAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTAGGGCTCTTTACTTAGGAGCG
ATTTTAGTTAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACACTTCACAATCTCCA
GCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCG
GATGGATCTTCCCACTAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTC
AGTGTCCGGCTGACGAAGGTGACTGGGTGACAGATCCCTTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATCACCGTAG
GTTGACGTTCCGGATCGAAATGACGGAGGATAGGTGTGGTCGCGATCCTGTTCCTCAGTTCCGGGAATGCGTGTTAAGCTCGGATCCACCGAGGTTCCGC
CTTTTCCGAACTCTGGTCCGTCGTCTCTATCCTGATTGGATCCTCTTTCTTTTGGTCCCGGGGGGGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGT
CGTACTACTTGGATCCCTTCGTGGATCCGACATCTCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCGGCAAAATCTACC
TCTCTCAATTCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGAATGTAGTAGTTCAAACTTCCCAAGAAGGATTGCATCGCCCGTAGCG
ACTGTGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTATGGGGTCCCAGGATCCCCTGGCTCTCCTGCTTCGAATGGATCCACTTCCGTATGGCCTT
CCCCAGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAA
CGGCATCCAGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGATCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATG
TCTAGAGAACAGTATCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCC
GGTAATCAATGCACAGACGTATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCA
GCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACA
TTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCATTTCAGCAGGT
TCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCTCGGC
GTGTAGATCCCCGCCTTCATGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGACCCTCTTTCACCTGGCAGT
CCTTCTGGCTTCGGGGGATCAGGTACCCTGGTATCAGGAAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTCCGGGTTTGA
CTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAAAGCTTGGATCCCCTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCT
CCGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGAGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCAACCCGT
CGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGA
TCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGAGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAA
CCATCGTCCGATCTTCTCATAATGGTCCAGTAATAGTATCTTGTCGCTGACGTTCGTGACCTGGAGGTATCGTGATCGACCTGGTCTC