Description :
From Genome Similarity Track
Location :
Scaffold_111:5- 2932
Sequence
2927 bases(100 bases per row)
ACAAGTAGGTGTGGGGCGCCCTACTGGTTTCAACGAAGGACCGGACCCTCCGGTGGACGCTCGACCTTCGAGCCCTCCCGTGCTCCAAGCACACACCAAT
GCCACCACTACGCCGGGCGACTCGAGACTGATCATCGTCAGCCTCCATGTCACCGGTGCCCGGCGACTACTGCGCGCGCCCCTTGACTCAGAAGCGACCA
ACAACTTCTTTCACGAGTCGTGTTTGTCGGTACTACGCAAGCGCGTCCGCGTCCGGAATGGTCCGGGCGGGATTCAAGTCAAACTCGCAGATGGTAAGGC
TCGCCGCGTTGCGCGGCGTGACGTGTTCTTGTCGTACACGTTCGACGGCTCCCGTAGCAAGGCCGACTTCTTGGTGATCAAGATGAATTATGTGTTTGGC
TGCATCCTGGGCATTCCTTGGCTTGCGTGATATCAGCCAGAGATTGACTGTGTGGCTCAATCGGTCAAGCGTTGACGTGGAATTGACGTGATTGAGGACT
TCACACACTTCTCGGTGGCGCCAGGAGACAGGTCCCACATCACAGTCGTGGACAAGATAGCAGTGCTCAGAGCAGTGCACAGAGCGAGCGATGGCCCTCT
CTGCATGGCTTGTGCTACGTTGTCGGACAAAGAGCCCTCGAGGTATCGCGAGGTAGATGATGAAGTAGTCGAGCAGCGGCTCCCACACAGCGAGATGGCG
GTAGAGCAGAGGTTCCCGCCGAACGATTCGGCGGTCGAGCAGATTCGGCTCCCGCCAAACGATGCTGCAGTTGATCTGGGCTTCCTGCGTGTCCCCAGCC
CGGTCGAGTACGGTCTTCCGCGCCTAGAGGAGGGTGATGCATCGTCGAGTAGCAGTGAGTCAGACTCGAGCGTGAGCTCGAGGAAGCCGAAGAATAAATC
GAAGAGACGACGCCTGAAGCCTCGTCGAGACTCCACGACACTCCACGTCCAGCAATAGCCCGCCGATGGAATCGGTCAGCACGCACGAGTACGTGGAAGG
AGGCCCGAGTCGGTCGCGCACTATCGCAGTCGCAAGTCCGACGCGTGGAGGGCGGCGATCACACGCCTTCGAGGCTTGTCCTGGAAGAACTTCGAGACCT
CAAAGCTGGAGACGTCGATCAAGTATGCTTGGTCAACGAGGCAGGCTCGATGGATGCATCAGCACATGCAGTCGCAATCGATAGTGGAAGCTTACGTCCG
CTAGGTGCTGAAGATAAGTCTGACCAGTGAGGAACGACTCCAAACGCAGTTTTGGGAGGCCTTGCGGGAGTCCGTGAATCCCGTATACGATACCGCCTGC
GAGTACGCCGACGTCTTCTCGGTCGCGATCCCCGCCGCGCTACCGGCGGATCGTGGGGTTCAGCACGAGATCAGCCTCGCACTAGGTACGAAGTAATGCG
TCAACAGAGAATGGCCACTTCCCCGTGATCAAGTGAAAGCGAACGATGACTTCTTCGAGGGCCATCGAAAGGCGGGTCACGTGCGCGAGAGTACCTCGCC
CCATTCAAGTCCAATGTTCTCTGTAAAGAAAGCTACAGGGGGATGGCGCATCGTTCACGCATTCAACAAATTGTATGATGCCACCACCCCCGCGCAGACT
CCGATCCCTCGGAAGGACACGGTACTGGACTCCATGGCTAGCAGCGTTATCTACAGCGCCATCGACCTGACCGACGGATTCTATCAGATCCTTATGAGAG
CATGTGATGTGCCTCTCACCGCCGTAAGCACACCGAGGGGATGCTCTGGGAGTGGCTCGTGATGCCACAGGGTCTGAAAAACGCGCGTGCCACCTTCAAT
CGCTTGGTCTCCCATGTGCTTCGTCCGCTCCGAGACTTCCCGCCGCGTTACTTCGACGACATATTCGTGCACAGCCGCGCTGAGGGCAACCTCAGTGCCG
TGGAAGTACATTTGAAACACCTGAGGCAAGTATTCCAGGTAATGCGAGAGAACAAGCTCTACGCAAACCTGAAGAAATGTGTCTTATGTGCACCGGCGAT
TCCGGTGTTGGAATGCTACGTGAGCAAGAGCAGTGTGCGCACAGATTCCGAGATGGTCTCGTCTATCTGTGATTGACCATCGCCTACAAGCTTCAATGAG
TTGCGTCAGTGGCTTGGCATTGTCAATTACTTGCCCAAGTATACGTAGAATTACTCTGGGTTGATCCAGCCGCTGTCATCGCTGCTGAAGAAGGACGTGA
TCTGGGAGTGGATATCGAACCTCCAAACTGCATTCGACTCGGTGAAAAAGGGATTGGCGTCTGCGCCAATCCTGAAGCCTGCTGATGACTCGAAGCCATT
TCACGTCGCCTGCGACGCAAGAGGTTTTGACATTGGCTGTGCGCTGATGCAGTTCGATAATGACGAACATGAACGCGTTATCAGCTATCAGTCGGTACAC
TAAAGCCAGCCGAGAAGAACTACCCAGTTCACGACAAGGAGCTCCTGGCAATGCGGTACGCTCTGATCAAATTCAGAATGTACTTGATCGGTGAAGCGTC
GTTTGCGGCTTACACTGATCACGCATCGCTGCGGACAGCGATGAAGAGCCTTCACTTGTCGCAACGGATGGCACGTTGGCTGATCTTCTTCTCCGAGTAC
AACTTCGTTGTTCACTACAAGCCGGGCAGGAATATCATTCTCGCCGACGTGCTGTCTCGGCGGCCGGACCACGATCCCCGTAAAGCGCTAGGACATCAGG
TGGCTGATGAGGACGACGTCGAATGCGCGGTCTGCGTGGGGTCACCCATCAACTTGACGCTGACCACGACCACGCTCCTGCTGGGCGACGAGATTGCTAC
AGCGTACGATGATGATCCTATATTCGATGCCATCATGAAGCGCCTGAGCGCTCCTAGTAGTGACACGTTTAAGTGCCCTTGCAAGGACCACGCGAAATCA
GATCGATCGATATAGACTAGACGGCAA