Description :
From Genome Similarity Track
Location :
Scaffold_304:5- 2674
Sequence
2669 bases(100 bases per row)
TGAATGCTCGGAAGAAATCGAACATAAATTCCGGCTCGCAATCATGGCATATCGCCTCACTCGCACCGAATCGTCTGAACACGCGCTCCTCGTAATTCTC
TGTGATCGTCTGGGCAGATCTGGACGAGCTTGCCTTTGCGATCACATATCCCGAGAACAAATCGACCCACAGCAACAGCTCGGTGTTTCCTTTAAAGGAT
CTTGGCAACGAAGGGATGTGATCCATAGCTATAATCTGAAAAGGGTGCGTTGATTGCATATTACCAGGTGATTCACTTCGATCCCCCGGACGTCCTTTTC
CCGTTGCACAATCTACACTTCTCACATACCGCTGCACACTTCGGTACAACCCACGCCAATGGAAATTCGCCCTGATCCGTTGATAGTTAGGGCCAATTCC
TTGGTGACCACCCTCCAAACTTTTGTGGTAGTGGTGCAAGAAGTCTCGCTGTAACTATTCTGGAACCACCAAACGAGCCAGTTTAGTACAATCTTCAGCT
TCGGTGGCCGATCTCGGACAGAAGAATAGCAGCCCCCTTTGATCTACTTCGTAATCCGGTGCGATCAGGGCACAAACTTTGGCTTCAGCCGCCTCTAATT
TAGCCACATCTCCACTCACATATATCTTCAGAGTAGATATCCAATATTCTTCGTCTAGTACTTGCTTATGAGATCGATCCGTATCTGCTGCATCACCTCT
TCCTGTAAAATCCCGGGTTGACAGTGTCTTCTTAGAGCTAATCAAGTGGTGGCCGCCACTTTGACTGCATGATCGACTCGTTCTAGTAATAGTAATTCGC
CTAACCGATTAAGAGTGATCAGATCGTGACTATCCTGATCCGAAATCTCAACTGTTCCTTTCTCTTGCCGTAGTGCTTGACTCGCCAACCGATCTGCACT
CTGACTTCAATCACGCCTCATATGCAAGAATTCATGGTCTGGCCACGATCGGAGTTTCTCCACCGCTCTATGTCTCAGCAACTGCAGTCCTGGTTCCCTT
GCAGTCAATTTCTCCTCGTATTTGGCAGATCCATAAATTCGAATCTCCGCGAATAGTCACTCGCCTCCTGGTCTGACCATCAATCAAATCGAAGGTGAGG
AGCTACCCTCGGTATTCTGCTTCATTCACGTTCAGATCAGGGGTAAACTCGGAAGCAGCAGCCACAATCGTCCATTCTGGCAGTTTCCATATAATCGCGC
TGTATGCTCCGCCCTTTCTTTTTACTCTGGCTGATCCATCGAAACTGGCTACCAGCAGGTTTTTCATTTCACACCTACCGTGGGTGGTGGCATGATTATC
GTCTGTCTTGGCTGCTTCCTCGGGGCGATCGCAATCAACACTTCATCTACTTCTTCACGAGGTGTTATACTTGCCGCAAGCATGCCGAGTATTTCATCTT
CTCCCTTCTCAGATCGCCTAATTTACAACGTCCAGTTCGATAGTAAAGCAGCCCATCTTCCCAATCTTCCGTTTAGAACTGAAGATTGTAGTAACCATAC
TAGTGTCGAATATCGCGTAAGCTCCGTAATATCACGGGATACTAGCATAGTATAGCAGATATCTAGCATCCGGACGAGAGCCAACACTTCTTTCTCCACC
ATCCCGTAGTTGACCTCGTTGGGCTTTAGCGTACGACTGGAGAAAGTGACAGGCCAATACACACCATCATATTCTAGAAGCATGGGAAGCTGATACAGCC
CACTTACTAGCATACACCACGATCACAGGCGATCGATCGAGATCGAAATGCTTTAAGATTGGAGTTGTGGCTATCTTAGTCTTTAGTAACGTGAATGCAG
TCCTTGCCTTCTCCCATCGATTCCTGCCCTCGGGATCGCGATCGTCCCTCGCAATTGGGTACCGATCGACATCGATCTCCGGTATTGGGTACAGATCGCG
ATCTTCCCTCGCAATTGGGTACCGATCGACATCGATCTCCGGTATTGGGTACAGATCGCGATCGTCCCCTGCAATTGGGTACCGATGACATTGATCTCCG
GTTTTGGGTACAGATCACGATCGCCCCCTACACTGCCTTCATGAATAGCATTAGGTCTTATAGCAGAGGTAGGTTTTGGAGCTTCACTCACGTGGTTGAT
CTCATGGAAATCTGCTTCGCGCAGTTCGTACATCACTGATGCGTAGACTACGAAGTCTTCAGTGAATCTACTGTAATAGTTGAGACTTCCCAAAAATGAC
TGCATCGCTCGCAGCGTCCGAGGGAACGGGATGTTCACCAACGATCCCAGATCTTTCGGATTAGCTTCCAAACCTGCGAGCGAGTTTTGATGTCCCAGGT
ATTCCACCTTGCGACATCCCCAAAAATGTTTGGCCAAACTGATCGATAAATTCCACTTATCGCAAACCTCCAATAATCTCTCCAATTTCTCACACAGGGC
CTTCCACGACGTAGCTGGTATTAATATGTCATCAATATAAGACCTTCGACCCAACACCGATGGTTTCGGACCGGTATCTGGTTCACCGTCGGTGAAGACA
TCGATCAACTTTGGAGATCCGGCCGCGATCGACTCAGATCTTGCGCCTATTTTCAAATACCCGTACAGATCGTTGTCGATCAACCATTGGTAGATCTGTG
GAGCGTTTTTCATCCCGAAAGGCATCCGTAACCACTCAAACTACCCTGACGGTGTGATAAAGGCGGAAA