Description :
From Genome Similarity Track
Location :
Scaffold_2606:5- 2619
Transcript NameFunction/comments
Phypl_g15249reverse transcriptase

Sequence
2614 bases(100 bases per row)
CCAGCTGAAGTCTCGACGCTACCGAGAGTGGCAGAACCTGGCTTACGGCGCCACTTGCAGCGCCGATAAAGACGGGACGAATGCCGAACCTGAGCTAGAA
GGACCGATGACCGAGCGCCCGGTATACAAGATCCCGCAAAGGATCATGCGCCGTGGCGAGGAGAGGCTGGCGAAGCGAGGCGAAGGCGCACGGACAGCGA
CTCCAGCGTTGGCAGCGATGACAGCGGCTCCACGGGATAAGGAGATGACTGCACAGTCAACGCACACATTCAAGACCGAAGAGCCAGTCAGCCAGCCGCG
GAAAGACGGGAAAGTGGTACCGCCAGGAGACTTCGAAGGATCTCAGCTGGAAGACGCCCCAAATTTGGAAAGATCTCAGCCGGGAGCTGAACGGTCGCCG
CCGGAAGATTCGTCGTCCGTAACCGTCGAAAGATCGCAACCGCCACCTGGAGGATCGCCTCCGGGGAATACGGAAGGATCGCGTCCCCTGAACCAGGAGC
CGACGAACGAAActgacgcggacgacgcaGGACTCATCCACGAAGGATCGGACCTCTTCGCagaagaactggaagcggAGATGGCGGTGTTGCCAGAGAT
CTCGGTTACGGCAGAAGTGCGAATCGGGGATCTGAAGGTGGGAAGGCCGACCGGGGATACACCCGAGGAAGCCacacagcaagaagagcgcctACGACAG
GTTATCCGGAGGCGACGAAAATGGCTTATCGGGAAGGGCAACGCTTTGCCGCCCGCGGCCGTGGGAGTCGTCTGCGATATAGATGTGGGCGACGCGAAGC
CCGTAGCGCAACGCGTCCGCAAGATCCCGCCCCGATTCAAAGAAAAGGTGTCCAACTTGCTCAAGGGCTTGCTCAGTGCTGGCATGATCAGACTGTTCAC
GTCGCCGATTGTAGTGATCGTATAGAAGAACGGGGTCGACATACGACTCTGCATCGATTACCGACTGGTGAACGGACTGACGCAGCTGATGGTTTACCCG
ATGCCGCTCGTGAACGACTTGTTGGAGGATTTGGACAAGTACCTGTGGTACTGCTCTCTCGACATGGCCAGCGGATTCTGGGTCGTCCCCACGACGGCTC
GAGCCCAGCTCATCTCCGCGTTCATTACCCCGTTTGGCCTCTTTGAGTGGCTGCGCATGCTATTTGGTTTGTGCAATGCGCCACAGATCTATCAAAGGCT
GATCGACAACGCGCTCTACGGATTCATGAGTCTGTCGACCGACCGCGATACTCGGAACGTCTTCGACGAGGGAGAGCCGGAACCCCCAGGGAACCACTCC
GTCCTAGGTCGGAGATCGTACATCGATGACATCCTAATCGACGGTATGTCGTAGGACGATTTGTGCACGAAGgtggagcggctgctggatgtCTGTGAAC
AATGGCATCTGCCCATAAGTGTGGAGAAGAGTGAGTGGGGTATGTCTCGAGTCGACTACCTGGGCCGCAAGGNAGGTCTCTGAAGCCGGAATTGaagcga
agccgaagaaCCTGGAATCGCTCGCGACATTGGAGTTCCCGCACACGCCCAAGGGTCTGCAGTCGTTCCTAGGTAGCCTGAACTACTACCGCCGGTTCAT
CGCAGACTTTGCGATCTACACGACGGCACTGTACCCCTCACAGAGGCCGACTTCGGAGCGTACGCCACCCGACCGGAAGTTCACAGCCAGGAGAAGTGGA
TACACGCGTTACGCGCAttcgagacgctgaaggccaagatcgccAAGACACCGATGCTGAAGCACTACGATCCAGACCGGGAACCGGTGGTCATCGTGTA
CGCCAGTGAATGGGCGATATCCGCGGTACTCGCACAGGATCATGGCGGTGTGTGCATGCCAGTGAAGTTCACCAGCCGCACACTCAAGCCCAACGAGCTG
AACTATGACGTCGCCGAAAAGGAGATCCTGGCTCTGTTGCGCGTCTTGAACGATTGCTTCACGATGTTGGCCGGGAGGGCGATCCGTGTCCTGACGCAGC
ATACGACGTTGGCGTGGCTTTTCCGATCTAAAGGACGGCAAGACCGACTGTCGCAGTGGGCCGCGATACTCTCACCGTGGAGACTCGAGATATTCTGGTC
CATgaaaggagaagaagagatCCTGGGAACGCTTGTCGCGAGTATCACGCCTAGAGCGTTCGtcgacacggcgctggaagagatCGCTCCACGTAGACGT
CCGTCGCGAATCACTGTCATCCCGATCCCGGCGGTTTCAtcggacgaagagctgcatgtTGTCAGCTTCGACAGAtcggccaaggccaagcgcgaagGCG
GATCATTCAGCGCGATTGTCTGGAAACTGCCGGGTTGGGAGATAATCCAAGCCGCATCGGGCTACGCGTCCGACCTCACGGTCAACGAGGCGAAATACCG
AGGATTGCTTCTGGgatgctcgctgctggaagggCTAGAGGTCGCACGACTGGTCGTCTGTGGAGACTCGAACCTCGTCATCCGGCAGATGCGTGAGGAG
ATGGACTGTAAGTCACCGGGCCTGAAATTGTTGTGACAGCGAGGTCGGAACGCATTACAGGCGTGGCCGCGCCATGAACTCTTCCACGTACGCCGAGACT
GGAACGCGAGTGCG