Description :
From Genome Similarity Track
Location :
contig_172:5- 2605
Transcript NameFunction/comments
g11892.t1reverse transcriptase

Sequence
2600 bases(100 bases per row)
CTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGG
GCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCTCGTGCGCGTATGCGGCCTT
CACGTCATCCACAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCG
CGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGG
CGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATG
GCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACCGATCGTGATCGTTGCATCAGTGCGC
ATCCGATCGCGAAATCGGATGCATCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGC
TTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTAC
TTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGC
GTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAG
CTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCG
AAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCC
GCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAG
GTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGC
CCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGC
CTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCC
GCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTT
CTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATC
TGCTCGATGCGTCCATCGTGCAGTCGCGAGCGAAACGCTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTTCCAGCCTCA
TCTTCTTGTATTGGGGACCAATATGTGGTGGAGAGGGATCACGAAATTGCTGACGCGATCGCAACTCACCAACGGTTGCCCGGACTGCCGACTGTCGGAG
GGGGTACTCCGTTGACCCGGCGGATCTTGACCTTACAGCTCACCTTGTGTACCCGACGGCTTGGGCGGGTTACGCTCTTCCGGTAATCACGCGAGGGAAG
TCAGTGGTGAACAGGGCAGAACTGGGGCTTGAGGGCCCTTCAGGGATGGGGGTGGTTGGCTGCCACGCGGATATGCTTCACGCAGCAGTCGGTTCGGGTG
ACGATCGTGTGTGATCGATCACGGGGTGTGTCCTTTACGGGGTCCTTTTCGATGCTTGCCGCCTCCTACGGCGGGGTCTTGATGAGTTGGAGGGAGAAGG
GGAGCGCACCTGGCCAAGCTATCCAGGGCTTCCGCGTTCTCGCTTGAGTCACTTCAGGTGGTTGTCCGGTCGTCGGGTAGGCCAATATATTTCCTTCCCC
GGAATTCGGAAGACCACTTGCGTGCTACAAGGAAAATCTCTCTCTGTTTATCCATTAAGAACTACGTGCCTATCCCCCATCTCTCTTGCGTATCTCATGA
TTGCTGACATTCTTGGACCTCCGATGTGCCGGTATTTGTGGTACGTGCTGATCTGATCGGCTGATTTGTACCCATGTCAAACTGATCGGTCGATCGGAAC