Description :
From Genome Similarity Track
Location :
Scaffold_788:5- 2541
Transcript NameFunction/comments
Phyin_T30-4PITG_21881Putative uncharacterized protein

Sequence
2536 bases(100 bases per row)
CGCACATTCCACCAGCGTCCGGTTCATTCGCTCAGCGACACCGTTTAGTTGAGGCGTGTACGGAGGCGTAAACTTCTGCACGATACCACGACGTTTGCAG
AACTTAGCCATCTCGCCCGACGTGTACTCGCCACCGCTGTCACTACGAAGCGTCTTGACGACCTTGCCGGTCTGTGTGCGACAAACTCAGCAAACTTGTC
GGCCACTTCTGACTTGTTCCGGAGCAAATACACCACACAGAAGTGCGAGTACTCGTCGATGAACGTGACGAAGTAGCGTTTGCCACTGAATGTCGACGTC
TGCATGGTACCACACACATCACTGTGAACGATTTCCAGCAGTTTCTTGGCGTGGTTGGGTGACTTAGACATGTAGCTCACTCGCGTTTGCTTGCCGAGTG
CACATCCATCGCACAGCTCCCACTATTTCACTGACGTCATGTTGATGCCTGCACTGTAGCCCTTTTCGACGATGGCGTCTAGACCGCCATGGCCAATGTG
ACCAAGTCGAAGGTGCCAGAAGTACGACGTGGTGTTCCCTTTGCGATCCTTCGAGCTTGCCGCATTGGCCTCGTCGGGCACAACTGGTGTCATGCACAGC
TTGAACAGCCCTTTGCCTTCACGCGCGCCGAGCTTCCAGTTGAGACCCTTTGCTTCCGCAAAACACCCATCCGTCTCGAAAGTCACGGGACCAACATCCT
TGGTGAAGCGACCAACCGAGAAGAGGTCGCGTGACAACTTGGGAATGTGCCACACATTCGAGAGCACGCCCTTCTTGGTCCCCCGTGGAGTCTTCATGGA
CATCACGATGTCGCCGGTCCCGACCGCCTGATCCACACCATCGTCCGCGAGATGCACGTCCACCGGAGACATCTTCTTGTAGTTCTTCATGTACTCCTTC
GAGTACGTCATGTGCTGCGTCGCACCCCGAGTCGACCAGCCACTTGTCACTTGTCTTGGTGGTCTTGCTCGCACCACCAACCAAGAAGAGAAACTAGCCC
TTCTTCATCGCGCGCGACGTTTGCTCGTTGCGGCCTCTGTCGCTCCGCATTCTCACGAATCCTCACCGGACACTTGGCGATCCAATGTCCTTGTTCGCCG
CAGTAGTGACACGCGCTTGTCTTTGGCGCCTGTTGGAAGTGCAAGATGTGCACGTACATCGACTCCAGAGTAGTATCCTATGTTAAGGCATATGGAAGGT
TCTAGAAGGATCTAGGCATAGTGATAGGTCTTAGTTAGCGGATGGTTGGTTAGTTCTCACTTCGAGATTGGTAAAGCCACTGACGAGGCCCCGGCGGGGG
CCGAAACGCGTCTGGCACGCGTTCAATCCAGTCATTCACATCGACTCGATTCTACATTTCCTACAGGTTATGAGCCCAAACGGCTTGGTATGGGCACTGC
GGTGTACGCGGAATACGCGCTGGGGGAGTCCACGCTCAAGTCGTCGCGGAAGCAACGGGCTACGACGACAGGGGGAGCGGAACATACAAGTGCGCGGTGG
ACACGCAGTCGCTCTTTGCGTTCGGGAAAAGGACGGGCGAGTTCTGCACAAGGAGGTGGTTTCGAGTGGTGTGAGTGGTGGATCGAAAGAGGTCGATCGA
GAAGGGGAACAACAACAAGCTCAAGCAAGGCTCAAGGACGGCTACAAGGTGTCAAGGGACGACGTGGTGGTGAACATGAGGGAGCCGGGAAACCTAGCGA
ACGCGGCAGCAACGGATACGCTGGCCAGCGCGCAGGTGGTAAACTCTACAAGAATGTATGCAGTGAAGAGGCTGCAGCTGACAAGCATCATGCGGAGAGC
AGCAGAATGGCTGTACGCTCGTGACCAAGACGGCTACGACTCATGTCGTCGAGGGGGAGTGTTGGAAGTGCAAGATGTGCACGTACATCGACTCCAGAGT
AGTATCCTATGTTACGGCATATGGAAGGTTCTAGAAGGATCTAGGCATAGTTATTGAGGGTTGCTGGTCTTGGTACTGTGTACCAGCTGTACCCATTAAC
CGGTCAACCTGAACCGGTCCAATACGATCCCGCTGTGATTATGGTAAGTTGTATATGCCATCCATGATTGGACGAGTAGAATGATTGGACGAGTACAGAA
TGATTGGATGAGTAGAATGATTGGATGACCTAGGTAGTGAGGACTGTGTAGGCCCCGATAAATCAATCACTTTCGAATCTTCCTTCTTCCGCTCAAGTGC
CTTCACTCCGGTCTCCGCATCAAGTGCAGAAGTCACCCCGTTCAGCTCCAAGCTTCGTCCCAACACCTCTACACCATTAACAGGTTATGAGCCCAAGCAC
CATGTCCTCTGCCCGTGACGCCTCAACCAAGGTCACCATCGACAAGTTCAACGGTGACAACTACGCGACGTGGAACCGCTACATGCGTGGCGTGTTTCTG
ACCAAGTCGATATGGCACGTTGTGAACCGGGAAACGACGCCGAGCTTCACGGACATCCGGACCAAGGACGACTACGTCAAGGCGAGCAACATTGCGTTCG
GACTGATGTTGCTCCACATGAACGCGGACTACCATC