Description :
From Genome Similarity Track
Location :
Scaffold_544:5- 2538
Transcript NameFunction/comments
g14021.t1hypothetical protein

Sequence
2533 bases(100 bases per row)
CAGTAGAACAGCAGGCCGTCTTCCCCCACTTCATAATCTCCAGCGATCTTGGCGCACGCTTTTGCATCTCGGGCAGTCAAGGCTGCTGCGTCGCCCCGCA
GGTACGACTTCAGGTCCACGATCCACTTCTCTTCATCCTGAGCTCGTACTAACCTCTCACTCCTCATGCGTTGAACGATCTCTTCTTGCATAGCTGCCGG
CACTTGACGGTGCCGTCGGGCTGATCGGGTCACTGCTGATACTTGAACGACGGGGTCGTCATTACTCGGGTGGAGCAACTCGCCCAGGCGGTTGATCGTG
ACGAGATCGCCAATTTCGCCCTCATCAGTTATGATCACGCCTGCTTCTCGTTGCAGTGCAGCGCTTGCCAACCGATCGGCGCTCTGATTCCAATCGCGCT
TCACATGAAGGAATTCGTGCTTCGGCCAGGCTTTCACTTGGTCCATCGCTTTCTGACGTAGTATCTGGAGACCCGGTGCCTTGCAATCGATTTCACCACG
CATCTGTCGGATGATCAAGTTGGAATCTCCACAGATCACAACTCGTCCTCTGTTCTGATCGGACAGTAACTTGAAGCCTAGCAGCAGTCCGCGATATTCG
GCTTCGTTGACAGTCAGATCATCGGCGAATTCGGATGCGGCAGATATGATCGACCACTCCGGGAGCTTCCAAACAATTGCACTATACGCTCCGGCGCTCC
GCTTGACACGTGCTGACCCATCAAAACTGACGACGAGCAGCTCTTCATCCAGCTCTACCGTCGGCGGGGCCATCACGATCGTTCGTTTGGGCTCTTTCAC
CGGTGCAATCGCGATCAAGGCCTCGTCCACTTCCGCTCGGGGTGTAATGCTGGCGGCGATCGCGCCCAGGATTTCGTCCTCTCCTTTCAAGCACTTCCTG
ATTTCCAAGGTCCACTCGGACAGCAGAGCTGCCCATCGTCCCAATCGTCCCTGGAAGCCCGACGAATTCAGCAACCAGGCGAGCGTCGAGTACCTCGACA
GCACTTTGATCGATCGGTTGGTCAGGAGCGTGTAACACACATCCAAAATCCGAAGGAGCGCCAAAACTTCCTTGTCCACTATGCCGTAATTCAATTCGTT
CGACTTCAGCGTACGACTGGTGAAGATCACAGGCCAATACATGCCATCATGTTCCTGAACCAACGCAGCTGAAATAGCCCACTTGTTGGCGTAGACCACG
ATCACAGGCTGGCGATCGGAATCGAAGTGTCGCAAAATCGGGGTGGTCGCAAGCTTGGCCTTCAGTAGGTCGAACGCCGTCCTCGCTCTAGTCCACCGAT
CGTCGGACTCCATTGCTCGGTCCTCATGCTTCCCGTGGTGCATCTCGTAGAAGTCCACTTCTCGCAGTTCGTATAAGATCGCGGCGTAAACGGCGAAGTC
TTCAATGAAGCGACTGTAATAATTCAGGCTTCCTAAGAAGGACTGCATCGATCGCAACGTCTTCGGAAACGGCAACTTCTCCAGCGATTCCAGATCTTTC
GGATTGGCTTCCAAACCTTCGGCCGATACCCGGTGACCCAAGTACTCTACCTTCCGATGTCCCCAGAAACTCTTAACCACGCTGATCGACAGATTCCATC
GCTCGCAAGCGTCAAGCAGTGCCTCGACCTTCTCGCAGATCGAGTCCCAGGTGTCGGCTGTGATCAGGATATCGTCGATGTACGATCGCCTGCCCAGCAC
CGAAGGTCCCGGGTTTGCCTCGGGCTCCCCTTTCTCGAACACGTCAGTTGGTTCCGTGTGGTCTCGATCAGGACTTATCCGGAGGTATCCGTACAGAGCA
TTATCGATGAGCCTCTGGTAGATTTGTGGGGCGTTCTTCAGCCCAAAAGGCATACGCGTCCACTCGAAGAGTCCGAAAGGCGTAACGAACGCGGAGATCT
TTCGCGCACGTTCCGTCATTGAGACCACCCAAAACCCACTAGCCATATCCAAAGAGCAGTACCAGAGTACTTTGTCCAAGTCCTCCAAGAGATCGTTGAT
CAGCGGCATGGGATATACCATCAACCTGGTCAGGCTATTCGCCAAACGGTAGTCGATACACAGCCGGATGTCGACTCCATTCTTCTTAATGATGATCACG
ATTGGGGATGCCCATGGTGAGGTTGATGGCTCAATCATTTTCGCGGACAACAAACTCTTGATCAGTTCAGACAGTTTCTCTCGGAATTGAGGGGCCACCC
TCCGCACGCGTTGGGCGATGGGAGCGGCTCCTCCAACGTCGATGTCGCACACCGCACCAATCGCGGCGGGTGGAAGGGCGTTCCCTTTACCGATCAGCAA
GTGTCGTCGCCGCCAGATGATCTGGCGAAGTCGATCGATCTCTTCAGGTGTATTCGTTTCCGGATCACCTACTTGAATGTCTTCGATCGTGACTTCGTCG
GTAGTGATCGGCACTTCGGGTAGGATAGCCATCTGGCTTTCCACGTCTTCCGCAAACAAGGCACCACCTTCATGGAAACACACCTCTTCGTCTTCTGGAG
TGCTGGGCTCACCAATCTGCACTTCCCCAGCTG