Description :
From Genome Similarity Track
Location :
Scaffold_2714:5- 2433
Transcript NameFunction/comments
Phyag_g12737putative polyprotein

Sequence
2428 bases(100 bases per row)
GTCGTGGATGGGTTCGCCATGACACGCGCCCTGCATAGAGAGAGCGATGGCCCTCTATGTTCGGCCTGTGCTATGTCGTTGAGTGGAGAAGAGTTCGACG
ACGGTGATTCCTCGCGTTGTCGCGAGGATATTAACGAGGCGGTCGAGCAAAGGAGGCTCCCGAAGAACAACGAGGTGGTTGAGCGAACGCGGCTCCCGCA
TGAGATCGGCGCCGGAGAAAACGAGCTCCTGCGCCTAGAGGAGGGTGATCCGTTCTCCAGCGATAGCGACACATCGGCCTCGAGCAGCGATTGTAAGCGA
AACAAGAAATCGAAGCGCCGACGCCTAAAGCCGCGTCACTTAAACGAAGGCGAAGATCCTGTAGTGGAGTCCGTTTGTGCGCTGGAGTACACTGAAGGCA
TGCCACATCGCAGCAGGACCATCGAGGTCGCGAGTCCTCCtcgcgacgctgctgcaataACGGGACTCCCAGGGCTGTCCTGGAAGAACTTCCTGCGCAC
CTTGAAAGCCGGTAATATCGAGCAAGTGTGTCTAATCACTGAAGCTGAGCCAGCATCGCACGACCTTAACGCGATCAACAAGGTCGGAGAGTCAGACTGA
CCTGTGGGAGCTGTGTCGAAGTCGGCTCGCGAAGAGCGCTTCGTGGCCCAGTCGTGGGAAGCACTCTGCGAATCGGGAAACCCGGTGGACGACATCGCAC
GCGAGTATGCGGATGTCTTCCCGGAGAAGATTCCTGCCGAACTGCCTGCCGAGCGCGGCGTACGGCACGAGATCGACCTCACGCCCGGAACGAAGTACTG
CGTGACACGACAGTGGCCACTGCCGCGGGACCAAGTTAAGGCTACCGATGAGTTCTTCGAAGGTCGCCGCAAGGCCGGTCATGTGCGTGAAAGCGTTTCA
CCGCATTCGAGTCCAACCTTctgcgtgaagaaggccacGGGTGGGTGGCGTATTGTTCATGCTTTCAACAAGCCAAACGATGCGACCATCCCAGCACAGA
CGCCGATTCCTCGCAAGGACATGGTATTAAATTCCATATCAGGAAGTGTGATCTTCAGTGCGATCGACCTGACGGACGGCTTCTATCAGATTCTCATGCG
AGAGAGCGACATACCTCTCACAGCTGTCAACACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTAATGCATCAGGGTCTGAAGAACGCGCCTGCCACTTTC
AATCGGATGATGTCCCATGTGCTGCGCCCGCTCCGCGACTTCGCGCCGAGCTACTTCGATGACATATTCGTCCACAGTCGCGCTGAAGGTAATCTCACCG
CTGTTGAGATACACCTACTGCACTTGAGGCAGGTCTTCCAAGTGATGCGCGATAACAAACTGTACGCGAATCTGAAAAAGTGTGTCTTTTGCGCTCCGGA
AATCCCGGTTCTTGGGTGCTATGTAAGCCAGGACGGCGTCCGAGCTGACCCCGAAAAGGTCGCATCGATCTGCTCTTGGCCGACTCCCAAGAACCCCACT
GAGCTGCGTCAGTGGCTGGGTCTCGCAAATTATCTGCACAAGTACACGAAGAATTATGCAGGCTTGATCCACCCTCTGTCGTCGTTACTGAAGAAAGACG
CCAAGTGGTCATGGCGTTCTGAACATCAAGTCGCCTTTGACGCCGTGAAGAAAAGCCTGGCTGAGGCTCCCATTTTGATACTTCCGGACGACACAAAATC
ATTCCATGTCGTGTGCGACGCCAGCGATTTTGCCATCGGTTGCGCACTCATGCAATTTGATGAGGAGGGCCACGAGCGCGTCGTGAGCTACCAGTCACGA
CAACTGAAGCCCGCTGAGAAGAACTACCCTGTTCACGATAAGGAGCTCCTCGCGATGCGCTACGCTTTGATCAAATTCAGGGTGCATCTCCTCGGAGAAC
AGACATTCGCAGTCTACACGGACCATGCTTCTCTGCGAACCGCGACGAAGAGCCCGCATCTGTCTCAGCGAATGGCGCGCTGGctgtccttcttcgccga
gTATAACTTCGTTGTNCGGACATCATCGCGCATCTCCGGAATCCCAACGCTGAGTCGTTGAAGAAGCTAACACGACCGACACGCGACGCTATCGGGCGCT
ACCGGCTCGACGACACCCTGCTGACGTATACGATGGACGCGTTCGATTCCCCGCGCGTCGTCGTTCCTGCCGATGACGACCTTCGCGCGCGTTTGGTCCA
CGAATATCACGACGCTCCCGTCGCCGGCCATCTCGGTCGCGAGAAGACATTCGCCGCGCTTTCCCGAGATTTCTTCTGGCCTAGGATGTACAAGTGGGTA
CGGAAGTGGATTCGTTCCTGTGAGTCCTGTCAGCGTGTCAAGCCCTCGCCTTCGTCACAGGCTCCCCTGCGGCCGCTCCCAATTCCCACAGAGGCCTGGC
GCTCTGTCAGCATGGACTTCGTGTTCGG