Description :
From Genome Similarity Track
Location :
Scaffold_679:5- 2356
Sequence
2351 bases(100 bases per row)
GCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGCACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAGC
TTTCGCGCGTGTTCACGCCGCCTAATCAGGCGTACCGTATCCGGTCGAAGCTCCTTGCTACCCGCCAGGGTAAGAAGGAGTTATTGGACTATGTCCAAGA
GTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCTTCTTCCGGAACTGGTCAGCGTGACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACG
GAAGTGTTCCGTGTACACCCTAACTCTTTTGAAGAGGTGGTGGATGTGGCATTGAATGCCGAGCACAACTTCAGGTCGGCGCGACCTGGTTGGAGCGCTG
GTAGCGCAAGTTCTTCGAGCGGTCCAGAGCCGATGGACCTCAGCTACGCTGAAGATGAAGAAGCGGAGCTTCTTGCTGCGGCGCAGCGCGCCGGCATCCG
CCGATGCTTTGTGTGCAATAGCACTATGCACTTGAGGATCTATTGCCCTCTGCGCAAGAAGCGCGAGGCTCCGCCGAGCCAACCCTCCGGGTCATCGCCG
GGAAACGGCAGCTCCCAGTAGGCGCGGGGAGGCCTACTGGGGAAGAACTGAGTTCTGTTGTGCCTATAAGAGGTAGAGGGCAACGGGGCTCAGCGCCGAA
GAGAGCTGAGCTCTCTTACCGAGACGCGTGTGTGCAAGCCGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTGAT
TGACTCGGGAGCCTCGGGCAACTACACCCGTCGCTCCACCTTGGAAGGGAGTCAGCTGTACGCTGAGGCACTTGAAGTGCCAACGAGAGATACGATCTCT
GTCCGTCTCGCGACGGGGACACTGGTAACTGTGTGGAAGGTCCCTGTCGACCTTAGAGTAAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCT
TAGACCTGGATCAAGGTATGACCTCATCCTTGGCATGGCATGACTGGAACGCCATGAGCCATGGATCGACTGAAAGTCGAAAACGCTAGGTGCGTCGCAC
ATTGCTCCTAGTGGACCTTTGGTGAGTCATGAACCCACCTCTGCTAAAAGCAGAAGCGCTTTTGGCGCGAGCACGAGGCCGAGGCGGCCCTAGTGCTGGA
CATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGCTATCCGCTGAGCGGTGCAGGTCAGGTCAAT
GACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAGTGGCACGTAATCCACTGAGTGGTACGAATCGGGTCGATGATCTACCGCTGCGTGACCCGAGGG
TCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGCCCAGGCGATGCAGGTGAACTGACACCTAGTTCACTGTGTGAAGGTCAAAAACCTCTTGGCTT
TCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTCGAGGAGTGATGGTGCTGTTGCACCCGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCC
GGCCGGGCTCGGTCGCGGAGGAAGAGGAGAAGAAGACGCAGGGCGTCTGTGACGTCTTCGACGTCGGACGAGGTGTCCAACGTGACGAGCGGTGATGCTC
CACGTGATTGCTGTAAACAGCTGTACACACTCGTGAACAGAGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGACACTCTGCCCGCTGCGGATGCTCT
GCTAGAGCTGGACGAGATGTCCATTGCCGAGTTTGGCGAAGCCTTAAATGCAGGCGAGCTAGCCGAGGTGGTCCTGGTGGGACCTGAGGAGGAGTTGAAC
TCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGCCACCAAGAAGACGCTGAGCGCAAGAGGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCT
ACCGGTGGTAAAGGAGTATGGAGACGTTGTCTCGAAAGACCCACCGACGTGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGA
ACCAAATACTGCGTAACAAGGCACTGGTCTTTGCCGAGAGAGCAGGGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTA
AAAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAACGCGGTCACTAT
TCCGGCGCAAACGCCGATTCCTCGCAAGGATGGTCTGCAGAACGACATGGC