Description :
From Genome Similarity Track
Location :
Scaffold_68:5- 2053
Transcript NameFunction/comments
Phypl_g2299hypothetical protein PHYSODRAFT_337182

Sequence
2048 bases(100 bases per row)
GATAAAGAAAGcaataacagttcagttttagcatcaaagagtgtatttactttgggttaggaataccgactctttgagtctcCAGTTAGTtatactagag
tgatctaagcctctgcggagacttaggggttcggagaaccacaagctaagactcggagagtcatacgtcttcctctgacgcactacgctacgcagccccg
ctgcagtACCTGTTTGGACGAGATTCGACCTGTCGCTCGACCGCAAGCAGAACCTCTCCGTTGACGCAGCCGGGGTGTTCTTCGTGCGCTTCATCCGCAT
GAAGACGTCTGAAGGGCGTCTCTCACCACCTGAAAATTTGTAACCACGAACGAGGCTTATGACACCTGGTCGGtatcgagctgcagcgggtAGGTGACGA
AGTCGGCGTCCGGGAAGAGCGCGATCGCTGTGGCGCTCATCACGCAGTCCGCTCCGTCCGTTGCCTTGATCGGCAACTTGCCCGAGATCTCGACCGAAGC
CGCCGtcacgctgttgctggcgaCTCCGCTGATGGAAGTACCGAACCACCCCGACGAATTTGTCGCCcttgacgctgccgctgctgctccaaagcctgtc
gctgccgctccgaagcttgccgctgctgctcctaagcctgccgctgccgctccaaCGATTTACTCCCACGTCAACCGTCTGCTCGCCCGCatcgcgtctg
ctgctggggtCGTAGCACCGCTGACGTCGCACTCGTTTCGCCGCGGCGGTGCACAGCACGTGAACGGGTGCGAGGGCCTCACACACCGCTGGATCTTTGA
CCGTGGGGCCTGGAACATGTCGACAACAAACAAGGGGCTcaacttcatcttcaacaCATGCAGAGAAGACCACATGGTCAGTAAAGCACTCAGCGGGAAC
GGCACGAAGGCCGCTGTCAAGGCGCTTGACTTGAAGCCGTTCGCGCAGAGACGCAAGAGAAGATCATCGGTGTCTAACGCTCGCTGTTCACAAGCTGCTA
CAAGATGGAAAGCCCCAAGTACAACCTGAGTCAGCAAGTAGCCGATGTCCTCACAGCTTACCTCATCTTGCACTACCCCCTGATGAAGAGGCTCGACGCC
GATGCGCTTGCAGTCAGACGCCTGGAGTCGGCAGCTGTGAATGGCGGCGTGTCTGTCGCTGAGCTTCACATCTCGCCACCTGTGGAAGCACCAACCCAAG
CCAAGAATAAGCTGCAGATGTGCACAAGAAACAAAGCAACAAGAGCAAGATCATCGACCATCAACGCAGTGTCATTGACCAGTTAATGACGATCATTAAA
CGCCAAGACGAGCGCTTAGACAACCTAGAAGCTAAAATGGACGGAACCCTAGCAGAAGACAAGAGTAAGAAGCGTCAGCAGGAACCAAGCCAAGAACAAG
ACAAACCCAAGCGCCGACGGACGTCGGTGACTTACATTCACGCGACGTGGGTCACGTGGTACGCGCAGGAACCTCGCTGGATGGCAGACGCGCcgaagcg
gcagcggtcaaacgcgaagcagctcgagggcTTGATGAAGCCCTTCGTCGCCGATGACTTGAAGCTGGACCCAAGCACTGACGACTATCGCGACTAAGTC
CTGGCGCTCGGGAAGAATGCGGAGGCTGCCGTACTAGCCTTCCTCAACACCCGCAAGATCACGTCGCGCGGCCACAGCAATCCGCAAGCACCTTCAGGAG
TTGTATGTGAAGGGTGACCTAAACGACAAGATCGCccggcacctgcagctgaGTCGTGCTGATGCCATCCGTGATCCAGACCGCCAAGACGCCCTGGAGC
CTGTGGCATCTACTATCTAGAAAGGAACGCCAAAGATAAAAGCAAGCACAGAAGCATAGGAGGCAAATACAATGTCTATTACATGTTTAGCACAACTCAG
AGTAGGTTAGAAGCAACAGTAGATACATCACACATCGTACAGCAACACAGTACCGACACCAAACGCAGTAGCGACAGCATACGCAAAGCCACCCCGTAGC
AAAGTGTGGCGACGGCTGGAGTTGAACCAGCATCCTCGGAGCCAAGCT