Description :
From Genome Similarity Track
Location :
Scaffold_1367:5- 2027
Transcript NameFunction/comments
Phyta_totarag12806ATP-binding Cassette (ABC) superfamily

Sequence
2022 bases(100 bases per row)
GGTCAAGTTGTGGAGGAGGGGCCTCACGACGAGTTGGTGGCGATCGAGGATGGCCATTACCGGAAATTGTACACAATTCAGGAGGAGAAAGCTCAAGAGG
AGGCCCaagctgcagtgtctgcgtTGGCTGAAGCCGAGAGTGGAGAACTGCACTCCCACAAGTTGCGGAATGGCAGCAGCCGTTCCGTGATAAGTGAGCA
tctggaggaggacaagatgGCAAGCCTGGAGAAGGAAGGCGATGCGAAGAAAGCGTTTACGATTTTCGATGCCATGGCTTTTTCTCGACCGGAGAGGCCA
GCATGTGTTGTGGgcatttttgctgctgctgtgatgGGTTGTGCTCTACCAAGTTCTGCTGTTCTTATTAGTGAATTGGTTGCGACTATGACGGAGAACT
ACACGCGCTACAAGGAGTTCAATATCCAGTCTGCTCTCGACGATCTCAACCACGATGTCACGGTGTATGGACTCTGCTACGTCGGTGGATCTATCGTGAT
GTTcctcgctgcagctactcAGACTTACTGTTTCAAGTACATGGCGGAGAAGCTCACTTCTCGCCTGCGTGATGTCCACTTCACCGCACTTTGCCGTCAG
AATATTGGTttcttcgacgagaagaagaatgcaACGGGAGCATTGACGGCAGATTTATCGATGTGTGCTACGAAAGTCGCTTTGATCTCGGGTGACTCTC
AGGGCCGAGTTGTCCAGGCAGTCTTCACATTCGTGGCGGCACTGGTGATTTCTTTCACGACTGGAAGTTGGCTGCTGACGTTGGTGATGTTGGCCGTGTT
CCCGTTCTTGATAGCTGGCCAGATGATTCGAATGCGCCAAATGAAGTCCTCCGGTCACATGTCGGATGAGCTTTCGGATGTCGGAGCTCATGCTTCGGAG
GCACTCAGTAATATTCGCACTGTGGTCTCACTTGGGTTGGAAAAATCGCTTTGTGGAAAATTCTCAGCATTGATTGAAGAGCCACTAGCAAGTGGACGTC
GTGAAGCTCAGCTGAACGGTGTGGCGCTGGGGTTCAGCTCGTTTATTCTCTTCGCTACCTACTCGCTCGTTTTTTGGTACGGTGGCAAGTTGGTACACGA
CCGTGAGATTAACTTCAAGGAGCTCATGCGAACGCTCATGGCCATCATGATGTCAGCCCAGGGTATTGGAAACGCTACATCTTTCCTGGGAGAATCTGAA
AATGCACTCAAGTCTGGTAAAGCAATTGTGAACCTTCGAGACCGCAAACCGCCCATCGATTCCTtccaagaaggtggacgacgtcTCGACAATCTCCAAG
GTAAAATCGAGTTCAAGAACATCCTCTTCCGATACCCTACACGACCCGAAGTTACGGTGCTACGAAACTACAACCTCATCATCGAAGCTGGACAGACCGT
CGCATTCTGTGGACCGAGTGGAGGAGGCAAGAGTACGGGTGTATCGCTAATCGAGAGGTTCTATGACCCTGTAGACGGacaagttcttcttgacggcgtc
gacaCGAAGGAGCTCAACCTGAACTGGCTGCGCAGTCAGATCGGTCTGGTCGGACAGGAACCCACGCTCTTCATCGGCACCATCGCTGAGAACATCGCGT
ACGGACTCACGGACAAACCCACTCAACAAGAcatcgaagaagctgccaagATGGCCAACGCACACGGCTTCATCACCAAATTCCCAGATGGCTACAACAC
GCAGGTGGGGATGAAGGGCGAGCAGTTGTCGGGTGGCCAGAAGCAACGCATCGCCATTGCGCGTGCTATCCTGAAGAACCCGAACAtcttgttgctggac
gaggcgaCGAGTGCTCTGGACTCGGAaagcgagaaggtggtgcaggaggctctggacaaggtggtggcgttGAAGCGGCGCACGACGATCATCATCGCGC
ACCGTTTGTCTACGATTCGCAAGGCAGACAAGATCTGCGTGGTGAGTGGTGGGAAGATCGCGGAGCAGGGCAGGCACCAGGAGTTGATTAAGCAGAAGGG
TATCTACGCGAAGTTGGTGCAG