Description :
From Genome Similarity Track
Location :
Scaffold_2125:5- 2006
Transcript NameFunction/comments
Phyta_totarag14133hypothetical protein

Sequence
2001 bases(100 bases per row)
CCTGGCTCTCGATCGTGCCGGATTGCTTCGCTTGCACCGAATCGTCGGAAGACGCACTCTTCGTAATTTTCCGCGATCGTTTGAACTGTTATCGATGCAC
TTGCTTTGGCGATCACGAAGCCGGTGAAGAGATCGACCCAGATCAACAATTCCGTGTTGCCCTTATAAGATCGGGGCAGCGCCGGGATGTGGTCCATAAC
GATGATCTGAAATGGGTACGTCGCTTGTAGGTTGCCCTGCGATTCACCTCGAACAGTTGGTCTCTCTTTCCCAGTCTCGCAGTCTATGCACTGACCCACG
TAACGTTGTACATCTTAATACGGTCCTCTCCAGTTGAAATGTGCCTTGATCCGCTGGTATGTCCTCCCGATTCCTTGATGTCCACCTTTCAGACTGCCAT
GGTAATGATGTAGGAagtcttcttgcagcgtctCAGGGATCACCAGTCGAGCAACGAGATCGCGATCTTCATTCGATTGCTTGGACGGCGGGCAGTAAAA
CAACAAGCCCGTCTCGTCGACCTCATAATCTTCAGCGATCTTAGGGCAGGTCTTCGCCTCTAATGAGGTAAGTTCCTGTACGTCCCCTCGCAAGTACTGC
TTGAGATCGACGATCcacttttcttcgtcttgtgcCATGCATATTCGCTCTTCCCTCATTTTCTGAACAATCTCCTCCTGTAACACTTCTGGGCTGCGCC
GCTTGCGCGACCTCGTCACGGCCGTGATTTTGGTCACTGTACTGTCAGGTCGTGGGATCAGTATCTCGTCAAGACGGTTAAGCGTCATCACGTCTTGGAA
CGCTTCCTCTGACGTCACTACCGTGCCTCCTTCACGCTGAAGAGCGGCACCGGCGAGTCGATCTGCACTTTAGTTCCAGTCTCGCTTCATATGAAGGAAA
TCGTGACTTGGCCACGATCTCAAGCGTTCCATAGCTTGTTGGCGTAGTAATTTTAACCCAGATTCATTGCACTCGTTCTCGCCTCGCATCTGTCGGATGA
CCAAATTCGAATCTACGCAGATAATTAGCCGTCCCCTGTCCAGGTCGGCCAGAAGATCGAAGCATAGGAGCAAACCATGATATTCCGCCTCGTTGACTGT
TAAATCGTCCTTGTACTGCGACGCAACTGAAATCATTTTCCATTCGGGTAAGCTCCACACAATGGCACCATACGCTCATCCACCTCGCTTTACTCGAGCT
GATCCATCGAAGCTGACCACTAGCAACTTTTCATCCGCCTCCACCGTAAGTGGCGGCATGGTAATTACCTGCCGGGACTGCTTCCTGGGTGCTATCGAAA
CTAAGATCACGTCGATCTCTTCACGTGGCGTGATGCTTGCAGCCATTACGCCCAGGATCTCGTCCTCACCTTTGTCGCacttgacgatctccaggGTCCA
GCTCGACAGCAACGCGGCCCAGCGACCGAGTCGTCCTTGCAATCCTCATGAGTGCACTAGCCATGCCAATGTGGAGTGCCGAGTCGGCACCTTGACCGAT
CTCGTCACTAGCTGCGTGTAGCAGACATCCCAAATacggagcagcgcgagaactTCCTTATCGACGATTCCGTAGTTGATCTCGTTAGGCTTGAGTGTCC
GGCTAGTAATCGTCATCGGTTTATATACGCCCCCATGTTCTTGCATCAACGCGGCCGCAATTGCCCACTTGCTCGCATataccaccaccaccggtCTTCG
ATCCGgatcgaagtgctgcaagatTGGTGTTGTAGCGATCTNGGTAGTCAACTTTGCGTAGACCCCAGAAACTCTTGGCAACACTGATCGATAGGTTCCA
CTCATCACAGGCGTCtagcatcttctccacctttTCGCACAACGTATTCCACCAATCTGCCGTCACAAGGATGTCGTCAATATAAGTTCGACGACCTAGC
ACCGACGATTCCTTTCCTGCGCCAGGCACTCCCTCCTCGAATACGTCAGTCTGGTTGGCGTGATCTTGGCCGCTTGTAATCTTGAGGAACCCATACAACG
C