Description :
From Genome Similarity Track
Location :
Scaffold_2833:5- 1947
Sequence
1942 bases(100 bases per row)
GAAAAAAACGACTCAGAATCAGATTAATTCACTTTACTCCGCGCGAGCTAGCGTGAATTGGACTCGAATTTAAGCTAACTCGCACGAGCTAACTAAACCA
AGCTTAAGATACTATATGAAAAGCTGACGAGCGATATGGTAGTGACGTTAATCGTTAAGACGATTCAATCCAGCGAACCCCATGCTCGAGGAGGCAAAAA
AGGATCTGGAGTGCTAATACCGGTGACGAGTGAGTGAATTGGCGGTAATATCACGTTGCATGACTGGGAGGAAGAAGTGTTACCTAGCACCTCGAAATGT
GACAGGTCGCGCCTCGTACCATAGACACCATAACCAATGCGGTGTGGATGTGGCTTGGTCACTTTGCGTCTCTTGTTGCGGATGATTGCAAGCTCTAAAA
CTCAATCTAGACCCTGGAGCGAATGGTTTTGGATCCAACAAAGGAGGAAGAGCGAGCATGGAGCCGCCGAGCCTGTTGCCGCATGTGGACGAGCTCGTGA
TGGAATATCTGCTGTTCCGGGGTTTTACTAAGGTGATGAAAGCTCTTCCCCTGTTTTTGGCGTCTCCAGCCGCCCAGTATCCGCGGAGCTATTAACCGAA
ACGCGTTTGTGTCAGAGCTTTCAAGTGTTCAGCGCCGAACGCAAGCGCGACCGCTCCCGGGGCTTTGACGTAGAGCAGATCATCTCACAGCTGCTGGTAG
CTGTGCAAACGTACGTGATGTTCACGCTGGAACGAGAGCTGTAGAGGCGCTAGAAACCGAGATGTCGAATATTTTCTTACCTGTGCTATGTATGCAGTTA
TCAGATAGAAACAGTGCTGGAGTCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAGTTTGAATCCCCATAAATCACCAGCCTTTTCGGATCCT
GTCCTTTTAGTAGATCCAAACCCAACAGGAGTCCGTTATACTCCGCTTCATTGACGGTGAGGCCCTCCGCATAAGTGTCTCTGGCCCGTACGACTTCCCA
TCCGGGCAGTCTCCACAGCATTGCGCTGTATGCTCTTCCTCCACGTCGTACGCGAGCGGATCCATTGAAGATCAGGACGTACAGATCCTCATCCACTTGT
ACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGG
CCAAAACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCATAATCTCCAGCGTCTAAGGTGAGAGTAAGGCTGCCCATTGCCCCAACCGTCCTTGTAA
GCCGGCCGACTTGAACAACCAAGCTAGCGTAGTGTGTCGAGTCAGGATCCGGATGGATTTTCCCACCAGCAGGTTATAATTGAGATCCAACACTCGCAGG
AGCGCGAGTATCTCCTTCGCCACCGCTCCGTAATTCAGCTCATTCGGCCTTAGCGTCCGGCTGACGAAGGTGACTGGATGACAGATCTCCTCATGTTCTT
GTACCAAGGCTGCTGAGACTGTCCAGTCACTGGCATAAACTATCACCGTAGGTTAACGTTCTGGATCGAAATGGCGGAGGATGGGCGTCGTCGCGATCCT
GTTCATTAGCTCCACGAACGCGTGCTGGGCTCGGATCCACCGAGGCTCCACCTTTTCCGAGTTCTCTTCCATCCAAATTGTATCCTCTTTCCGTTGGTCC
CGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCCGGCGTTGTGCTACTTGGATCCCTTCGTGGATCCGATATCTCCAGGGCCAGAGCTTGTTGGATTT
TGATCCGGACAGCTGAAGTGGTCATCGCAGCAAAATCCACCTCTCTCAATTCATAGAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTA
GTAGTTCAAACTGCCCAAGAAGGATTGCATCACCCGTAACGA