Description :
From Genome Similarity Track
Location :
Scaffold_3842:5- 1931
Sequence
1926 bases(100 bases per row)
AGTGCAGATAGCTTGGCCAGCGCCGCTTTACCGTAACAATGTAGTGTTGAAGTGGAGAGAGAGGCCGAGCACCTGGATCTCGTTACGTTGAACCGACTAG
ACGAAGTGGGGGTAGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAAATTCTCGAGGC
AACATTTGTGAAGAGAGTCCGCATCAAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGA
GACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGTCTTTCTCTTTCTATTGCCCCCCTACCAAGAGA
GTCTATGTAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACAT
CAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAAAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTG
AGACAGGCAAGGGCAGGCCCACAATCGGAGGGGAATCACCTGGAAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGAGATCATATCCCCTCGT
TGCCCAAGTCGCTCAAAGGAAACACAGAATTGTTGATTTAGGTGGACCTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAGAC
CATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGA
GCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATTGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCCTAGAGC
ACTCAAGATGTACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGT
GATACCCCATTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCGTTATGCAGCACCACGAAGAGAAACCGAGATCCAAGGCG
ATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAA
GACGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATG
GACCGTTCCGGGAGAGCGAGAAGATTGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATTTAAGCT
GAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCGATCGCGTCGACTTCGACGAAGTCCTCCTACCGGAAGATAGT
TGGAATGTGGACCTCGAGGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCAGGGAAGCGAACTAGATACGGGCGGATTTACCGTGAATTTC
TGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCG
TAACAGATTCATCGTGATGTAGTCTCATGAAGAAGAGTAGGGAGGGGACCCATGGATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACAG
GAAGGGTGTGGGCCAGGAGGAGGAGG