Description :
From Genome Similarity Track
Location :
Scaffold_311:5- 1905
Sequence
1900 bases(100 bases per row)
AGCTTTGCAATGGGCAAAGAGTGTTTCGCGATAACGTCCAAGTCGTCGAAGGGCACGGACGTCTGCGGGTCGTAGAGGATCGACATCTCCTTCGCACCCC
ACATGATCTTGTGCTCGCCAGCGCCGTTAGCAGCGTCTCCAGGAGGTGTGCAGCTGACCTTGTGGTCCTTCCAGTGGCCTCGCTAGCATTACGCGTCGCA
GTAGAAGGTGCACTTGCATCGTGTGCAGCGCTTGAGCTCGTTGCCGGGGGCAGCGCGTTTGCCGCACTTGGCACAACGACGCAGCTCCGGGTTCTCTCCA
TGAGTGCAAGCTTCTCGCCAGGAGGCAGCACGCGGCGCTCGAGATCAGCGCGCGTGTAAAAAAAAAAACGGCGTCAAGCAGCGGATATTGTCGCCACCTT
CGCCGTTCAGTTCACTGCCCGTGTGCGCGCTGATGGCGAACGAGAAGACAGTGCCTCGGCCAACCTGGCGACGCGCATCCAGCCGCAGCTCGCCCTCCCC
ACAGCGTCCACCTGAATGGCCTGGCGTTCGGCGAGAGGCAGTTCCACGGCTTCAGTTTGGCGTATTTATCGCAGGCCGAGTAGAAGGCGGACAGTGCCTC
AGTCGTGACTCCAGCGCCCGAAACCAGTCCAGGACGCTCGCTCACTTCCACCACGGACACAAGGTCCTTCCAAATCAAGTGCTGCGAGAGCTCCTAAGAA
ATAAGTAACAAAACACAGCGTCAGCATCAGTACAGCCCCCACCGACTTGCAATCCAGACCAAAAACGTACTGAAAATGAGCATCGATGCCGTCCGAATCA
GGAGAGGTACGAGCACTCGATCCCCAATGCCGAGTAGCTCTTCCGCAGTTGCCCCCACAAAGTTCTTGTCCGGGAACACGACCTTGTCAGGGCGGGCGCT
AACTGGTATTTTGACAATCCTCTAACCGGTATCCTGGAAAGTTGACTTTTGACACGCTTCAAGTTCTGGTGAAGAGACCTTAGTAAGTCTTTTTGAAAAT
GGCTGTTGATACGGCCCATGTTTTCTAAACGGGATAGGGCGCTAAGAACCCTCTGAAGACCAACCCAGCGTTGAGCAGGGAATACCATGGCCAGCCACAG
CACTGGGGTGAAGTTTGCAGGCTCTTCGTGCATCTCAAATGCCACTGGTGTCCATTTTGCTCAGACGCTCCCGATAGATTTGAGTCAATTTCACCCCCTC
CAACCGAAAACATGTGTAAAAATTGTTTTGACGACTTAGGTATTTTTGAACGAATATTAGTTAATAGTTAAGGCAGATGAAAGCTTACTGACTTTTGGTG
TGTATGTTTTTTCTGTCATTTACGTAATTAGTTGATTTAACATATCAGCTGTTATAGATAGGCGTTTTATACTAAAGATAGGCATTTTAGATGTTTCTTA
AAATACTGCTCAAAATTTCTACTCTCCGTTTTATCATACCCCATTCCGTGAAAGTGAGCTGATTAGTGTGTTGTCCTCAAACATAGCCCATTCCAGAAAT
TCTGTTTCAAAACAAATATTTTATCGAAGAAGTTTTGGTAGTGATTGTGTATCGTGCTGCACGATATATACTTAAGCGAAACGTCTGGGGGCGTATTAGC
AAAACATCTCCTAATATGAGGGGTGTTGGCCACAGTAATGAAGTATTACAATATCTTACATGTCTTACAATATTAGGGGACCTGGGCCATGAGGCCCGGA
GATTCGCAGTTCTCTTTGAGAAATACTTCAAGTAACTAGGAACAACGACAAGAAGAAAAATGCATTGTGGTCGTAGAAGAAGGAGGAGAGCGCTCCCTCG
ACGGTTTTTTGCTAAATGATGGCACTATTGTATCTGGTAAATCTCGACAAATGGTATTCAACTGCCCGCTCATCATGGATGGAGGCAAGGCAGGCGTAGC