Description :
From Genome Similarity Track
Location :
Scaffold_4879:5- 1719
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4879-fgenesh-gene-0.0Expression site-associated gene 8 (ESAG8) protein

Sequence
1714 bases(100 bases per row)
CGAGTGGACACCACCGAGCGCCGAGACATCTTGGACGCGCTTGCAGTGCTTGAGCGAGAGCGTGTGGACACCTCCGAGCGCAGAGACGTCCTCCACCAGG
TGGCAATAGCTCAGGTCGAGCGTGTGGACGTTCGTGAGCCCCGACACGTCCCGCAGATGCGGACACCCCGCGAGCTTGAGCACGCGAACGCTCTTGAGAC
AACGAACGTCCTCCAGGCCATCGCAGAAGCGCAGATCCAGCTCCCGAGCCTTCGCGAGAGAACTCACGTCGGTGATGAGCGCGCAGCCAGACAAGTTCGC
TCTCTGAACCGACGTCAGCGAGCCAATGTCGCGGAGACCGACGCAGCGGTAGGCGTTGAGAACCGTGACGCCACTCAGACTGCCAAGATGAGTGATGCTC
TTGCAGAAGCTCACGTCCAACTCGTGCATGTTGGCGACTCCGTCCAGCGAGGTGACCCCCTGGCAGCGACTGAGGACCAGACGTCTGAGGTTGCGCAGCC
GACTGACGTCCGTGATGCCTCTGCAGTTGGAGAGATCGAGCTCCTGCAGCGAGCCTCGGGCCGCGAGCGTCGAGATGTCGCTCACACCGTCGCATTGCCG
CAGCGAAAGGATGTGGACGCCAGTGAGAGCCGAGACGTCCGTGATCTCCTTGCACAGAGACAGATCCAGCGTGTGGACAAGACCTAGAGCCGAGACGTCG
CGCACGTTGATGCAACCCGTGAGGTCGAGGTCGTGGACGCCGCCCAACGCGCTCACGTCTGTGAGGCCCAGACATTTGCGCAGCCTCAGTGTGTGCACTG
CGCCCAGAGCGCTCACGTCCGTGACGTTGATGCAGCCAGAGAGGTTCAGCATGTGCACGCCGCCCAGACTGCTGACGTCTCGCAGACCGATGCACCCGCC
CAGGTTCAGATCGTACACGTTCTTGAGCGCCGACACGTCTCGCAGCTGTGGACAGTTGCGCAGACTCACCTGCCTAACCGTGGCCAGCGGTCGCACGTCG
CTGAGTCCGCGACACACGTTAAGCTGCACGGACTCGCAGTTGGCGAGCGGCGAGACGTCCGTGACTTCGTGGCAGTACGACAGGTCGACGCTCTTCGTGT
GGGCGAGGAAGGACACGTCATTGAGGCTGCTGCAGTAGCTTAGGTCCACGTGCGCGATGCCGTCAAGCCAGTGCAGGCCGTGGATGTGCGTGCATCCGTC
GAGTCCGAGCGCCTCGAGGTTGTTGATACCGTCGAAGAGCCGCACGCGCGGGAAGCCCGAGAGATTGAGTCGCTGGATGCGCTTGGCGAGGATCGCAGCT
TGGAGCTCAGACGAGCAGGCGTAGTCTTGCGCAGCTGACATCAGTCGGGCATCCTCCTGTGCGAGCATCGCGGTCTCGTCTTCCGGGAACATCGCGATCG
TCTGAGGCAGAGAGTGGTCGGAGCGAAGAAGGTGATTGTGGATGTTCTCCGGCTCTGGCGATGCAGCTTTCGACTCGGGCAGCGGCTGGAAGGACACGTT
CGTCAGGTTGGGCCAGATCGCCTGCACGCGCACGAGCTCGTCCACGGTCGTCACGAGCTGTGCCTCCATGCGCAGGTCCACGTGCTTGTGCACGACGTCG
TAGCAGAACTGGTTCACCTCGGCGAGCGCCACGGCCTCGTTGAGTGTGAGGAAGTCGACGAGGACGCCGTTCCAGAGCTCGAGCGGAAAGGCGACTTGGA
GGTAGTTGGCCATG