Description :
From Genome Similarity Track
Location :
Scaffold_3008:5- 1716
Sequence
1711 bases(100 bases per row)
GACATTGAGAGCCCCCTTCGAAAGCTTCTTCCATCACACGCCTTCGGGTCTTTCCGGAAGCATTTTCTGCGCGACCAGAAAGTCAAGAGGACAATCGAGC
AGTCTGCTTGATCACCGAGTCTTCTCGGCGGAAGAGATCCACACGGTCGCTACGACAATCTTCCACTTCGTCCAAAGAACGCTGAGCCGAAGTCGGCGCG
CGAAGAGCGCTTCGCTGTCCAGTCGTGGGAGTCACTCGCGACTCGGGCAATCCAGTATACGACACCGTCCGCGAGTTCGCGGATGTTTTTTCCGACAAGA
TTCCAGCTGAGCTCCCTGCTGACAGAGGCATTCGCCATGAGATTGATCTCACGCCGGGTTTCAAGTACTGTGTGACGCGACAGTGGCCCCTCCCACGCGA
TCAGGTTAAAGCCATTGACGACTTCTTCGAGAGCCGCCGCAAAGCGGGTCACGTGCGCGAGAGTACCTCGCCACACTCGAGTCCGACGTTCTGCGTGAAG
AAGGCCACGGGTGGTTGGCGCATTGCTCACGCTTTTAACAAGCTAAACGACACCACCATTCCAGCACAAACGCCGATCTCTCGGAAGGATATGGTACTTG
ACACCATGGGCCGCAGGGTTTTTTTCAGCACCATCGACCTGACCGATGGCTTCTATCAGATCTTGATGCGACTCAGCGACGTCCCGCTCACAGCGGTGAG
CACTCCCAGCGGGATGCTGTGGGAGTGGCTTGTCATGCCGCAGGGCCTGAAAAACGCACCAGCCACGTTCAATCGCATGGTTTCCCACGTTCTGCGCCCA
CTTCGCGACTTCGCTCCGAGCTACTTCGATGACATCTTCGTTCACAGCCGCGCTGAGGGCGATCTCAGCGCCACAGAAGTTCACTTAAATCACTTACGAC
AAGTGTTCCAAGTCATGCGCGAAAACAAACTGTACGCGAACTTGAAGAAGTGCATCTTCTGTGCCCCGGAGATCCCGGTGCTTGGCTGTTATGTGAGCAA
AAATGGTGTCCGAGCGGATCCTGAGAAGGTCTCGTCCATTTGTGCGTGGCCCACGCCGCAGAATTAGACTGAATTGCGTCAGTGGCTTGGCCTCGCAAAT
TATCTCCACAAGTACACGAAAAATTATGCTGGTCTGATCCAGCCATTGTCTTCATTGCTGAAGAAAGACATCACGTGGTCGTGGACTCCCGAACATCAGT
CAGCCTTTAATGCAGTGAAGAAAAGCTTGGCGGAGGCCCCAATCCTGGCGCTTCCAGATGATGCAAAGCCATTCCACGTTGTTTGCGACGCGAGCGACTT
CGCCATCGGCTGTGCACTGATGCAGCTCGACGACGAAGGTCGCGAACGCGTCGTGAGCTACCAATCCAGACAGATGAAGCCCGCTGAGAAGGATTATCCG
GTCCACGACAAGGAACTCCTTGCGATGCGCTACGCACTGATCAAATTCAGAGTGTACTTACTCGGTGAGCAGACATTCGCGATCTACACAGATCACGCGT
CGCTGCGAACAGCGACGAAGAGCCCTCATCTCTCTCAGCGCATGGCACGATGGCTGTCATTCTTCTCCGAGTACAACTTCGTCATTCACTACAAGCCAGG
CAAGAATAACATCCTTGCGGATGCCCTATCTCGGCGCCCCGATTACGATCCACGCCGAGATTTGGGTCGTCAGTCACTTGAAGACGCGGACGACGACGAA
TTGGACTGCGC