Description :
From Genome Similarity Track
Location :
Scaffold_876:5- 1706
Transcript NameFunction/comments
Phyci_177599Hypothetical protein
Phyci_183431Hypothetical protein
Phyci_185389hypothetical protein

Sequence
1701 bases(100 bases per row)
CAACTTGGCATACATTTTTGCGCCGAGCGTCGAGCTCAAAAAGCACGTCCGGGACCGCTTGCAACGCTGGGCGATGCGTCTATGTGGTCTGCACTACACT
ATCGAACACATTCCTGGCGAAAAGAATGTGTGGGCGGATATCGTGTCCCGTTGGCATGCCCGCGAGATTGTTGCTGTGGCCGCTGTCCAGACACGCAGTC
GTCACATCGTCCCAGTGGAAGAGTTATCACCGCTTCGTCCACTTGCTGACGAGCAGTTTATTTTTCCCAAGCGCGCTGACCTGCACGCTGCTCAACTTGC
TGCCTCTCGTGAGCGCTCTCGGTTGCAGCACGCTTCGGAAGAGGAGGATGGTGTGGTGACCGTGGACAACCGCCCCTGGGTCCCCACGAATGCAAAGGAC
CTGCTCGCCCGAATTTTTGTCGTCGCTCATTGCGGTTCACAAGGCCATCGCGGCCAGGATGCAATGGCCTTGGTGTTGAAAGAACGATTTTACACCGTGA
ATCTGGACGATAAAGTGGCCAAGTTCGTCCGACAGTGTCTACTCTGCAAGCACTTCAAGGGCCCTCGTCAGATTCCGCGCCCATATGGCCCGCTGCTGAC
ACCGACGCAGCGAAATGAAGTGGTGCATTGGGACTTCCTGTCCCTTGGTGATGGTTTCGGCGACTCGAAGTATCTGCTGGTGGTGAAAGATGGAATATCC
CACTTCTGTGAATTGTTTCCGTGCGCTACACCAACTGCCTACGTCGCGGCGGAATCACTCACACTCTGGTACGCACGGTATGGGCTACCACAGACTCTGA
AGTCCGACCAGGGCACACACTTTCGCAACGAAATGGTGAAGCACCTCGCAGCGCGATTGAAGATGGAGCTGCACTTCACGCCAGTATACTCACCATGGTT
GAACGGGACGATTGAAAGGCTGAACAAGGACGTCCTTCAAGTACTCCGAGCGCTGCTCATGGAGTATGGCCTGGACCAGCACGAGTGGCCATATCTGTTG
CCTGCTatccaagccaacttaaaccacactccagtcccatctcttgccggtcatgctcctgtggaggtgttcacggggctgccagcttcatcagcattgg
ACGTAATTGTGGTGCCCGCCGGTAGCGAGCACGCTGAACGCGTAGTCGACCTCGACGATATTGGCGGCTTTGTGGGCCAGCTTCGCTCTTCGCTGCACGC
TATTCACCAGGACGTGTCAGATGCAAAGGAACGCCAGCGACTCCGCGACATGGCATCGCACAAGGGCATTCCTgtcaacttcgacgtcggtgactttgtg
ctatggtcaagaatcgaccaacgtctgccgaacaacaagctgttgggtcactgggtcggccccttcaaagtggttgctgctctcgcccactccttcgaga
tagagcacctggtgactggacgaaagtacgatgtgcacgcttctcgtcttaaattctacgccgacGCCGAGCTGGACACGACTGCAGAGCTGTTGGAATT
GGTCTCCAGCCAGGGCATGCTCTTGGGAGTCGAGAAGTTGGTCGACCATCGCTACAACCATGACCTGAACCGCTGGGAGCTTTTCGTCTcatgggccggt
ctccaagccatcgagaactcatgggagccgctgatcacgttgctgcatgatgtccccgcgaaggtgcgcgagtacatcgacgcggctgaagatgacgaac
t