Description :
From Genome Similarity Track
Location :
contig_143:5- 1670
Transcript NameFunction/comments
g13766.t1hypothetical protein
g13767.t1hypothetical protein

Sequence
1665 bases(100 bases per row)
CTTCGCTAATGAAGATGAGCCGCCAGCTAAGAAGGCGAAGTTGGGAGCTTCGGCCACGGTCGATGTGAAGACCGAGCGTGAGCGCAACACCCTGCTGCTA
ACTACCGTGGTGCGCGCGTTGGACGGCTGTTTCGTGCATGACAATGATGGCTTTATCGAGAAGGACCGCTTCGACGTTGTGCTGACGCCGTTGGTGGATG
TGCTGGACGTTCTGCAGTACGACACCTCGATGCGCGAGTTCGTGCTTGAGACCGTGGCGCCGTGCCTCGCAAACCTGGCATGGGCCGCTAAGAGCGACCT
TCTGTGGAAGCCACTGCATTATGCGGTGCTCATGAAGTCTCGTGGAGATTGCGCCCCGGTGCGTCTTGCGGCTCTAGTGACAGTGGAGAAGTGCTACCAG
GTGATTGGTGACGAGTTCCTGGCCATGCTGCCCGAGAGTATTCCGTTCCTGGCGGAGCTGATGGAGGACACGAACGGCGAGGTGGAGAAGACGTGCCACC
GCGTGATCAAACAGATTGAAGACATCTCGGGCGAGTCCTTGGACCAGTACCTCACAAATTAAGCTGCCAAGCACAGGTAATAGATAGGATAGCCACACTA
TGTAGAGAGACTCAAGCTTTCAGGCGGCGCAAACCTCAGCGTCAGCTGTGCTTCACTGACTCATCTTACGGTCCGACCGCCAACGCAAGACCGTTTTTGC
ATTTCATAACGCGTAATAAGATGTAGATGATACACTTCCATCAGATAAGTTGCCAGGCTTGTTGTCGTTTTCGGCACGCGCGTGTTGGATCCGGTGAAAA
ATCAATGACCAACTCGGACGGTTTTCCTTGAATCGGCATGTTGCTGCTGCGCCGAGGCTCCTAGGTTTCTCCAAAATGACCGAGGTGGTGGAGTCCCTGT
ACAACTGCGAATGTAGTCTGTAGAAGCGTTCGCCTACTAGTGGGGCCCAAGTTTCAGCTTGGGCTCGGTAGGTGAGGATGCAGTGTAGCGCGACTCGAGC
GTAGTCACCATAACTGCTACAAATACAGCGTTGCAAGTTGCAGAGTACCTTTGTATCATACCAGGAAAGAACATAAGGTGTCTGTTGCGAGTGGGCGTGG
ACATACATATCGACAGGGTGGAACTCCTGGACGTCAAGGAGAGCATGCCGTAGGTGTGAATGCCGCAACAGACACCGCAGCTGGCAGGTTAAACTTCTTG
AACGAGAAGAGATGTGATTCTGCCGAGCTTGTCCGTCAGTTTCTTCCTGAAGAATCGTGCTGGAGTTCATCAACGCTGTAGCATTTCTGGACCATCGTCG
AAGAGACGTCGTCCTAGATGCTATCGAGATCGGCGACGGTGTCAGTTCGTATTCGATACTTTATCGAGTAGGCATCTTTAGAAACTGAAAGATAATCTTT
AGTTTCCCAAACGTACTTAGTCGTGGTTCTAGGAATAAAACCATTTTTGCGTCAGAATAATGAAGCATGCTCGTTGCAACGAGCCCCGCGACTATGACTC
CCCGTCAGCAGAAGCGTCTGAAGGAGGCGACGTTTCCACACTCGATCCAAGCCCTCCCTCATATTCTGAAACACATCGACATGTTCGCCATGACTGTCGA
AGAAGCAGCCGTGGAAGCCGCTGCCACCAACGACATCGAGTGGCTGGAGAGACTCCTGGCCCGAA