Description :
From Genome Similarity Track
Location :
Scaffold_1979:5- 1620
Transcript NameFunction/comments
Phymu_g13798hypothetical protein

Sequence
1615 bases(100 bases per row)
CCGTTGGCTTGAGGTCGATACGCCATCGTAGCCCGCTGCCGTTGTCCCAGGATCTTGTTGAACGATCTGAAGAAGTCTGACATGAATCCGGGTTCTCGAT
CACGCCGTATCATCTCGCTCGCCCCAAATCGCCGGAACACACATTCCTCGTTATATGCCGCGATGGTCTGAGCTGACCGCGACGCGCTAGCCTTCGCTAT
CACGTATCCCTTGAACAGATCCACCCAGATCAACAGCTCCGTGTTGCCCTTGTTAGATCTGGGCAGGGACGGGATGTGATCCATCGCTATGGTCTGGAAC
GGGTACGTGGCCTGTAAATTTCCAGGTGATGCACCCTGAGCAGAtcgtgctcgtccacctcatAATATGCCGCGATTTTGCCATGTGATAGATATTCAGC
CTGGGTAAGATCTGCGGTCTGTCCGATCAGGTATTTCTTTATCCTGGCGATCCagacttcttcgtcttgcaCTTGTTTAATCGGATCGATCCGCATCTTC
CGATTAACTCGCCCTGTAAGACGGTGGCGTTAGACCCCATACAGAGATTGGCTCAATAAGTGACGGCTAATATTCGCAACGCTGGGTCATCAATCTTGGG
TACTAGAATCTCGTCCAGCCGATTCAGGGTGGCTAGATCTTCGTGGTCTACGTTGCCGTGGATCTCGATCCCGTTTTGCCGCTGCAAAGACGCGCTCACC
AAGCTGTCAGCGCTCCCGTTCCAATCCCTCTTCACATGCACCAGTTCGTGATCACCCCGCCCTCTCCGGTGATCGAGGACCCTCTGCTTCAGTAAAGCCA
GTCCTGGCGCCTTGCAGTCGATCTTGCCGCAAACCTGTCTGGTCACGAGGTTAGAGTCGCCATAGATCATCAAGCACCGGCGTTTGAGGTCCTTCAGCAG
TTTAAGTCCCATCAACAGACCATTATACTCGGCTTCATTGGCAGTAAGACTCTCGGCATACCCCGATCTGGCCTTGATCACCGTCCATTCAGGCAAGCTC
CACACGATCGCGCTAAaagcgcctccacctcgcttcACCCGAGCTGATCCGTCAAAACTTATAACCCacagctcttcatcttgatcCACAGTGGGGATCG
ATGCTTGGATCCGGTGTTTAGGCTCCTTCCGAGGTGCGATTGCGGCCAATGCCTCATCGATCTTGGATCTCGGCGTGATACTGGCAGCGATCGTCCCCAG
TATTTTGTGCTCTCCCTTCGTGCACTTCGTGATCTCGAGTGTCCATGGTAAGGGGAGTACCGACAATTGCTCTAGGTGACCCTAGAGCCCCGCTGACTTG
AATAGCCTGGCGAACGTGGAGTGTCTAGTCAGGACCCTGGTCTCGCACACAACTAGTAGATTGTAGTAGAAATCTAGGACCCACACCAGCACTAGCACCT
CCTTTTCCTCCACATTGTACTTCAGCTCGTTTAAAGGCGACAGGATGGTATATCTCGTCGTGTTCTTGCATCAGCGCGGCGGAGATCGCTAAGTCGCTAG
CATATACAATCACCACCAGTGATCTTGTCACATCGAAGCGACGCAGGACCGGCGTAGTTGCGATCTTCATTTCCAATGACGTGAACGCCTTGTGGGCCTT
GATCCACCTTTCATC