Description :
From Genome Similarity Track
Location :
Scaffold_773:5- 15494
Transcript NameFunction/comments
g5359.t1hypothetical protein
g5360.t1POM76328.1 Hypothetical protein PHPALM_6441 [Phytophthora palmivora var. palmivora

Sequence
15489 bases(100 bases per row)
GCTTCTCGTTGCAGTGCCGCACTTGCCAACCGATCGGCGCTCTGATTCCAATCGCGCTTCACATGGAGGAATTCGTGCTTCGGCCAGGCTTTCACTTGAT
CCATCGCTTTCTGACGTAGTATCTGGAGACCCGGTGCCTTGCAATCGATTTCACCACGCATCTGTCGGATGATCAGATTGGCATCTCCGCAGATCACAAC
TCGCCCCCTGTTCTGATCGGACAGTAATTTGAAGCCTAGCAGAAGTCCGCGATATTCGGCTTCGTTGACAGTCAGGTCGTCGGCGAATTCGGACGCGGCA
GATGTGATCGACCACTCCGGGAGCTTCCAGACAATTGCACTATACGCTCCGGCGCTCCGCTTGACGCGTGCTGACCCATCAAAACTGACGACGAGCAACT
CTTCATCCAGCTCTACCGTCGGCGGCGCCATCGCGATCGTTCGTTTGGGCTCTTTCACCGGTGCAATCGCGATCAAGGCCTCGTCCACTTCCGCTCGGGG
TGTAATGCTGGCGGCGATCGCGCCCAGGATTTCGTCCTCTCCTTTCAAGCACTTCCGGATTTCCAAGGTCCACTCGGACAGCAGAGCTGCCCATCGTCCC
AATCGTCCCTGGAAGCCCGACGCATTCAGCAACCAGGCGAGCGTCGAATACCTCGACAGCACCTTGATCGATCGGTTGGTCAGGACTGTGTAACACACGT
CCAAGATCCGGAGGAGCGCCAAAACTTCCTTGTCCACTATGCTGTAATTCAACTCGTTCGACTTCAGCGTACGACTGGTAAAGATCACAGGCCAATACAT
GCCATCATGTTCCTGAACCAACGCAGCTGAGATAGCCCACTTGTTGGCGTAGACCACGATCACAGGCTGGCGATCGGAATCGAAGTGTCGCAAAATCGGG
GTGGTCGCAAGCTTGGCCTTCAGTAGGTCGAACGCCGTCCTCGCTCTAGTCCACCGATCGTTGGACTCCGGTGCTCGGTCCTCATGCTTCCCGTGGTGCA
TCTCGTAGAAGTCCACTTCTCGCAGTTCGTATAAGATCGCGGCGTAAACGGCGAAGTCTTCAATGAAGCGACTGTAATAATTCAGGCTTCCTAAGAAGGA
CTGCATCGATCGCAACGTCTTCGGAAACGGCAGCTTCTCCAGCGATTCCAGATCTTTCGGATTGGCTTCCAAACCATCGGCCGATACCCGATGACCCAAG
TACTCTACCTTCCGATGTCCCCAGAAACTCTTAACCACGCTGATCGACAGATTCCATCGCTCGCAAGCGTCAAGCAATGCCTCGACCCGTCTCGCAGATC
GAGTCCCAGGTGTCAGCGGTGATCAGGATATCGTCGATGTACGATCGCCTGCCCAGCACCGAAGGTCCCGGGTTTGCCTCGGGTTTCCATTTCTCGAACA
CGTCGGTTGGTTCCGCGTGGTCTCGATCAGGACTTATCCGGAGGTATCCGTACAGAGCATTATCGATCAGCCTCTGGTAGATTTGTGGGGCGTTCTTCAA
CCCGAAGGGCATACGCGTCCACTCGAAGAGTCCGAAAGGCGTAACGAACGCGGAGATCTTCCGTGCACGTTCCGTCATGGAGACCACCCAAAAACCACTA
GCCATATCCAAAGAGCAGTACCAGAGTACTTTGTCCAAGTCCTCCAAGAGATCGTTGATCAGCGGCATGGGATATACCATCAACCTGGTCAGACTATTCA
CCAAACGGTAGTCGATGCATAGCCGGATGTCGACTCCATTCTTCTTGATGATGATCACGATCGGGGATGCCCATGGTGAGGTTGATGGCTCAATCATTTT
CGCGGACAACAAACTCTTGATCAGATCAGACAGTTTCTCTCGGAATTGAGGGGCCAGCGTTGGGCGATGGGAGCGGCTCCTCCAACGTCGATGTCGCACA
CCGCACCAATCGCAGCGGGTGGAAGGGCGTTCCCTTTACCGATCAGCAAGTGTCGTCACCGCCAGATGATCTGGCGAAGTCGATCGATCTCCTCAGGTGT
ATTCGTTTCCGGATCACCTACTTGAATGTCTTCGATCGTGACTTCGTCGGTAGTGATCGGCACTTCGGGTAGGATAGCCATCTGGCTTTCAACGTCTTCC
GCAAACAAGGCACCACCTTCATGGAAACACACCTCTTCGTCTTCTGGAGTCCTAGGCTCACCAATCTGCACTTCCTCAGCTGAGTCCGTACCAGCGATCG
CCCCCGTTGAGGGGGACGGGAGCACCGAAGCCACCACGGGTTTTGATCCTTCATGATCACGTCGCAGGATTTTGGTCGGCAGGTCATACCGAGGTCGATC
CACCATTGGTCCTTCTGGCAAAGGTTCAGGTTCCTCGTCGCTGACCTGATCGGTTGTCGCTTGGAACGCTAAATTCTGCCATTCATTGTATCGACGTGAG
CCGATCAGGACAAATCCTGGAATGCGAGGTACTTGACCACCAGAGAGCCACATGCCAATACGCGTATCATCTTGGAGTATCAGCTTCTGATCGCTGACGT
TCGTGACCTTCAAATAACGCGTCTTCCCTAGTCCAGCCACCAGGCTCGGCACCCAACGATCACCATGGGTGACCCAGAGTTTCCGATGGTCCGAGAGAAT
GAGTCCCTTCCGGAGCTCGACCGACCTTCCAACTTCGATCACACTGTGTTCGCCCAGATTGATCGGTTGCACCTTCTCTCCGAAGAGTTGCCGCCGTCCA
GCTAACTGGATTCGCACCTCATCCGGGAGATTGATCGATCCGTCAGCTAGGTCAAGACGAATGCCTGCTGGCACCATGAAGTCCATACCAAGTATCAAAT
CCTGACCACCAGTGGGTGGTCCAACCCAAACATCGAAGTAATACACCAGCGATCCCGCGAGCGTGATCTTGATTCTGGTACGTCCTTCCGCCATATAGGG
ATTCTTGCCAACACCCTCACACTCCAACTCCTGATTGTTATCTATGTAGCACCCCACCTTACGAGCAAAGGCGGCATCCAAAATGGACACCTCGGCGCCA
CTGTCAAACAGCAGAGTGGCTTTTTCGTTGTTGATCTTCCCCACGGCTTTCGCCTAGCGAAACTTCTTGTCTGGCACATGATACTTCCAATATCCTCGGG
ATTCTCCATGCAAGAGATCCAAGGCCATCGTCACTTCCGATCGCGAATATTCGTCGACTTGGTGGATGCTGGAGATCGCCACGGTACGCTTATCATGAAG
ATCACATGTATTGTCAGTCGGCCGAATCAGCTTACTCACCTCTGACTTCGACTGTTTCTCGACATATGCATAGATGCAGAACTGAGAACGCTCGTCTCGT
ACCGGATTCAAACCCGGCGAGCGATCTAGTTTAACATCTTCTCGGCTGCTTGAGGGAGCATCCCGCCGTGCTTGTTCGGGTTATACCACTGATGGATCAA
GTTGTAAAACTCTTCCATCGGGCACTCTCCGGCTCCGTGGATCTCGCCGCAGGCTTTGCAGGTGAAAAGACAGCGATCGGTCGGATGACCCTTCTTGCCA
CACTTCTCGCACGTCAATCGTTGCCAACAACCCAAGTCCGTATGCTTGGTCGATCCGCAGTGGGAACACGGCTTCCTCGGCAACTCTCCTTCCGGTACCC
CAGTCGGCTTGTCGTGTCTGCGGCTGTTCGCATCTCGGTTCGGGCGTCGCTGATCTTGCTCCTGCGTCGATCGCACCCCTTGATCAGCCGTAGCGGCCAG
GTGGATCTTGCACAGATCGCTTTCTCCAACTGATCCGCTGACTTCTGGCTCGGAATCACTCGAACTCGCTGCTTTTCTGATCGCGCGAACTGCACGAGCG
TTTGCAGATGGAGCGACACCAGTTGGCGCCTTCGTTTTCGGCTTGATTGATCCATATACCGCTTTTCCTTGTCGGGCTTTGGCTCTCTGTCGCGCCCGTA
GCGTCTCCTCCAAGGTGTCTGCATCGGGAACCCTCAGCAGGGCTAGTTGGTTAGCCAAGTCGCGATCGTCGAGAGTCTCGATGAAGTGATCAACGTGTTC
ACGTCGAACTTCGATCGACCCATCCTTGATCGGAAGATGCGCTCTTAGACCGGCGACGTTCAGACGGTGCAGATATTCCAGCGGCGATTCTTCCGATCGC
TTCCGTGCATGGTAGTATTGTCTCGCGACAGATACTCCCCTGCCACAGTATTGCGTCTGGAACGTTTGAGATAAACTCTTCCAGTCACTCCGTGTAGTCC
TGCTTAGCTGTCGGTACCAGTTACGCGCTGGTCCCTTGAGCAGATCACCGAACACCAAACACTTTTCGCTATCGGGTGCTTGGTCGCGGATGAAAGCAGA
CTTCATCTTGCTAAGCCAACCCCTGGCGCGGTCCTCGTCATTGTCCTTTCCGGAAAACACCTTTAGTTCAGAGATCGCCGACACTTTAATTCGAGTAGCA
GAGAGCGATCCGCCACCAGAATTTTCGGCGGACGCGACCGCTGCGCGAGTAGGAGTTCCTACGCTCAGATCATCCGGATCGTATTCGCTTGGATGAGAGT
GGACCACGTGGTTTGATTCCACTGATTCCATCTCGACGTCTTGAGCTCCGGGCGATTTGGTCCGATCGGTAACAGGGCGATCGGCCGTCTGCGGGACTGC
CGACGTCTGTTGCTCCTTCAGAAAACGCTCCATCGCTGCATTGAAAAAGGTTTGCATGCGATCGGGTGTTGCTTGGGCTTGGCCAGATCTTGGGTCAGCT
GATGTCTTGACTTCCGATCTATCTTTGTGTGATCGTAACATGGCTACTCCCGCTGGCCCGAGTGTCATCCGTTGCAGTTCAACCGAGCTGTCTGACCCCG
CCTCTGACGTGGCAGACGCATATTGGGAAGATCCCGTCTGGCTGCGGACCGTAGGCAATCTTGCTTGCTGGATCGGGACCACACTGCCCACCATAGGCGT
CAGTTTGGCGAAGAGAGTTAGAGTTGCTTCTCTGATCGTTTCCAGTTCCAGATCAAACAGTTCGTTCGCATCGAACGCACCAAGAACTATTCCAGCCTCC
TTGAGCATTCGCATCAGGGCTTTGACTGCGTCCAACTTGTTCGACACTTCTCTGGGTGCCTTCACCGGACCTTGGAGATCGCCGATCAGCTTCAGCTGCA
TGATCTTCATCGTTCGATCTTCGGTCAGGAACTTGTACAGGTCTTTCCGATAGAAAACAGATTCCAACTGCTCTTCTGTCCAGCCGTCATTGTCCGTCTG
GTCCTCAGCATCCGATTCTGGCGCTTTCATCTTCATGCGCGATGTCTTCGACTTCTTCTTCGGTGCCGATCGAGAGATTGGAGGAGTAGTTGTGGATGAA
AGTCCTTCGGTTTTCACAGTCGGACCTTCATCCGGCGGATCACGATTCGCATCGTGATCCGCGGGGGCCCCCGTAGGGGCCTGGGGAGGGGGGTAAGGCT
TCTCTTCTAGGTCCATTTCTGAACCCGCCTCCTTCGCATCGTCAGAGCTCCTCCCGGCACTCTGTCGATCAGATGATCCTGGCGCTTTCAGCGCCGTCGA
CGGCGATCCATCTTCCGTCGACGACTCCATTCCTGGTTCTATCTTGCTCTTGACATCCTCTTGAGTAGACTCACGGTGAAATCCCTGTGAGTTACCAGAA
GATCCGGGCACGCGCACCATTGTGGTGGAGCGGGATCACGAAATTGCTGACGCGATCGCAACTCACCAACGGTTGCCCGGACTGCCGACTGTCGGAGGGG
GTACTCCGTTGATCCGGCGGATCTTGACCTTACAGCTCACCTTGTGTACCCGACGGCTTGGGCGGGTTACGCTCTTCCGGTAATCACGCGAGGGAAGTCA
GTGGTGGGCAGGGCAGAACTGGGGCTTGAGGGCCCTTCAGGTATGGGGGGTGGTTGGCTGCCACGCGGATATGCTTCACGCAGCAGTCGGTTTGGGTGAC
GATCGTGTGTGATCGATCACGGGGTGTGTCCTTTACGGGTCCTTTTCGATGCTTGCCGCCTCCTATGGCGGGGTCTTGATGAGTTGGAGAGAGAAGGGGA
GCGCACCTGGCCAAGCTATCCAGGGGCTTCCGCGTTCTCGCTTGAGTCACTTCAGGTGGTTGTCCGGTCGTCGGGTAGGCCAATATACTTCCTCCCCCGG
AATTCTGAAGACCACTTGCGTGCTACAAGGAAAATCTCTCTCTGTTTATCCATTTAGAACTACGTGCCTATCCCCCATCTCTCTTGCGTATCTCATGATT
GCTGATCTTCTTGGACCCCCGATGTGCCGGTATTTGTGGTACGTGCTGATCTGATCGGCTGATTTGTACCCATGTCAATCTGGTCGGTCGATCGGAACCC
ATGTTGATCCGATCGGTTGATCCGAACTCATGTACCCAACTTGTGGTACCGCGACCAAATCTGCCAAGATCGGAATGATGGTCTTCACATTCACCATCCG
GTCGTCCGACCGTTGATGCCGCCCATCCCAGGTCCAAAGCCATCCATCCGAGCCCATCAACCAATCACCTGGTCGGACACGATCCATCCATCTCCAAAAA
CTTCTGGTCACTTCTCCACAGACGCAGTACGGGTGTTAGCACAAGATGGACAAGGGACGGACTCATGGTTCAGTGTTCCAGGGAGGCACGACAATTGCTA
GTGCAGAAGCGCAACATAGAGCAGGCGGAACGAGGTGAATGCCGGACGGAAGCAATCGAAGACGTCCCGCTCACGCAACTTTGGCTCGGCTCCTCCCTAG
GAAATGAGTGCGAATGGAAGAAATATCGCAAGTTAGTGCCGGCCGCACAGATACTAAGGGTCAAAGACGTCCTACGCATTTCCCACGCAGAATGCGGAGC
GGTGATACTAAAGCCGACGACACATTCGATTCCGATGGCAAGCGATGTCGCACTCATCTTCCAAGTAGTGGGGCTAAATTTGCTGGCCAACTGTCCGGAG
GTAGTCTTCAACAAGACCTAACAGGCTGTGCTGCAGGTCCGACACAAGTTGGAGGACCCGCACTGTGGCGTTGGGTTTTGGTGCCGAACTGTCACGGTTT
GGCTGACGTTGCACCTTTCAGTGAACGGCGACAGAGCGTCTTGATTGGCGGGTCTCATTTCCCGCGCTATAGTGACCTAGGAACAATAGTGACCGAGGTC
TCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAGCCTCGTTTGTACCCATTTCGTGTCGTACCCTCGGCTGTGTAGAGCCGGCTATACGATTTCCC
ACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATC
AGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTGGCTTCTCTTAGGGTCTGGATACGCTCGGCTGCGTGGGATGCCTG
TCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAATCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACAAGGAGTGTCGGTCCCAA
TATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTAGGCGTGATTGCCGGTACCCTCACT
TCTGAGGGACTGCGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACCCAACCTTG
GTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGT
TGTTGGTGGGACTCACACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAACTGGTGCTGCGACCCGGGATTGGTGTGACCTTCTGTGTGTCT
TGGTTGCATATAGGTTCTTACCTTAACGAGCATTCGAGAGAAGAAAGAAGAGAAGAAGAAAGAAGATGGCGAAAGAAGCGAAGTCAGCGGTACCAGCAAC
GCCGGTGAGGTCGAGTGGAACGCGTACCGAGGGTTCGGGGCGTTCCGGTCCGTCGTTTGCGACGCCGAGTACGTTGGCGTCGATCAACGAGCGTTCGGAC
AGTTTTGATGAGCCGATGGACTATTCTGACGCCAAGGAAGATGACGACGAAGATGACCTGGAAGAGAAGGCAGCTATGCCCGAGCTTTCGGAAGCCGCTG
CAGTATCTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGGACGAAGTGGCTGGTCCCGAACCAGCCAACGGTTACGA
CGAAGATGAGTCCGACGATCACCGATCGTCGGCGATGGCCGAGGATGCGAATTCTCGGCCGAACGGCGGCCGGCCTCCTCTTAACGGAGACACCCCGGCC
GCCAACCGAGTTCTGGGTCGATACCTAGAGCTCATGAAGGTGAAGAGCAATTGGATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGG
AGCTCGGTGGTGAGTTAACTGTGCCCGTGGAGTACTCGGCAGGTGGCCGAGGACACGGTGCAACTCCTGCGCGCTATGGGATGTGAACCCCAAGTGTTCC
CATCGGAAGCAGACCTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGC
GGGAGTTAGCCGTCCACCGAACGTCCGCCGCGCATCGGATCCGGTCGACCCGTCCATGATTCCGTTGCCAGTGACCCCTGGGAGACGCCCCAGAGGGTCG
ACCGAGGCCGGAATATTTTCGGCCCAAGGTGCGACGTCGACATATTTCCAAGACTCTCACATGGTGACGCCGAGGTCGGTCAGTCGCACAGAACGACTGG
CGAGAGAGGCCGAGGGATATCGAACCGCTCCGACTGCTGGACGAAGTGCAAGTCGGACGCCCAGCCGACGTTATGACCTCCGCGATGACTCATCTGACGA
AGATTCGTCCAACGTCGGAGACACCGGGGGCGACTTGACGGGAGAATGGGCACGCCAAATTCGTGAGCTGAGCGCTGTGGGGAATGACAGTGCGACACCG
AGGCTAGAGATCGCTACGCATCTCCCACTCGGAAACATCAAGCCGTACTTGGGACTCCGCGACAAGAGCGAGAAGTCCATGCAGTGGCTCCGAGCGTTCA
TATACGAGATGAAAGGGACGCACACGCCGCCTAACGAATGGTGCATGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCTGCATTGGTACCGACAGCTACC
CCGCAAAACGAGACGCACGTGGAAATTGTTGAGCGATGCGTTCATTAAGTACTACTGTTCGAGGTTCAACCAGTCTGCGAAGGCTCGGTACTACTCGGCC
AAGCGAGAGGAGAAGGAGCACGTCTGCGACTACCTCAACCGACTTAACGGCTACGCTCGCAACGCCGGAGTGCAGTTCGAGCATGGCGGCCGTGATGCAA
AGGACCACGTCGAGCATTTCTTGGATTCGTGCGACGACCGAGGTCTAGAAGAGCGTCTGTGCCATGTCCGAGTTAAGAACATTCACGACCTCGAGGATAT
GATCAATGATATCCTTCGTCGCAGAGAGCGAAAATCTGGACGCGAGTCCTCGGTCCGCCGCCCTCGAGGGCAAGAGGTAGCACGCCGACGCGATGGTGGA
CGCTCCGAGGATCCGCGGGACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCGAGAAGACCGTTACCAAGACGATAACCGTCGCCGGG
ATGACCAACAGTATCGACCGAGGGTCACTCTCACTGACGCACTGACCAACATAGTGACAGCACTGAATGCGGGACGCTCGGTGGACGCGCGTGGAGGATA
CCCGGAAGCGTACAACGACGGATATGATGACACCGAGGAGTATGGGCCGGAGTCTCACTCTGGCGATGACGACCGATATTCCGAAGGGTACTCGGACGAC
GGATACGCGTCGACCGAGGACCGAGGCCACGTGGCTGCTGCAAACGACTCTGAACGTCGCAATGCGGCTGAAGGAACGTTCGCTCGCGCCGACAACCGTC
GGCCGAGGGCAAGTAACGGCCAACGCCCGTATGACCGAGATGACCAGCGCCGAAACTCCACCGGACGCGATGGTCGACGCCAATATGGTCCATGCGCCGC
CTGCGGCGGACTCACCCATTTGGCTCACTACTGATTTAAGCGATGCAAGATGTGCACGCAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAAGAACTC
ACGAATCTCCTCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGA
AACTGGGTTAGTCCCAATCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGACTATATGTTCGCATTCGCAGGTGTGGGCAAACGGCCTGATGAC
TTGAATATGGAATATGTGAAAACGACGGAAAATGTAAAGGAGAGAGGCGTAAGCCTCGGTGAGAGTGAAGTGAATGGACGACGTGTGGACGGAGACGGAG
TGGAGCTAACCGATGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATGGG
GTGGTGGTCATCCCAGCGCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGGGCTGTAAACGACTCGCGAACGAGGATTCTGCTGGACACTGGA
GCGAATGTCAGTGTGATTTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCGAGGAATTAACCCAG
GGGTGATGGAGACCCGCAGACGAGCACTCGTTAAAGCCACGCTAGGCTGGGAGCGCGTGTACGAATTTGAAGTATGGGTTATGGATCACAGTGCAGGAGT
GGACGTGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGGTACTGCGAGACTACCGGACGAGGTAATGGTGCCCTTG
GTGAAGTCGCAGAACCCAGCAGAGGCTGAGCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTTGTCGGTCCCAGGGCGTGAGTGGCGAGAAT
TTAGGTTACCACGACGACGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGAGGGCA
GCCGACGATGGTGCGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACACGAATCGGTACTGCTGTGGGTGAAAAAGGGTGACCTGTCGCAA
GGGGATGGATACACTCGTTTGAACTCCGCTAAGTATGAGGAGTGGCAAGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGAACGCA
AACTCTACGAACGATGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATCCGACACCTAGCGGCATCCTACCTCGACCATCCGATGACTTGGA
AGGCCTAGATGAGGGCCAGATAACGTTCGCGAATAGGGGCACTGAGGAACCGACAGAACGAGACCGAACGCCGTTGACGACTTCGGTGCAACCCTCTGAC
GAACCTGTTGGAGATAGATGGGTCGACGAAGATGACGACTCGGTGGCGACCGACACCTCTGATGGCGCGGATACAACGTATACGAGTGAAGAGAACTCCA
TCCCAGTCCTCGGTGATGACCCGGAGACCCGATTGGACTCTGCCTTCGTAGCAATGATGCATGAGATTGCCGCGGGGGACGGTTCAGGTAGTGGGAACAC
CGATACCAATACGTCCGAACATTTAGCGAATGAGATCGAGTTGACGGACTATGCACACGAGTTGGCGTTCTTACCGGACCTGACCGAAGCCTCGGAAACG
GTACTGGATTATTCAGGACCGAATGTTCTGAACCCGAGCGCGACAGCCCGTCAACAAGAAAGTCTCGCTGCGGTGCTGAAACGACACGAGAAGATCATGA
TTGCGAGTGGGAATGCTCTGCCACCACCGGCCTACGGTGTGGTGTGCGATATTGACGTACAGGGGCATCTACCCATCAAACAGAGAGCCCGGAGAACACC
GCTCCGACACCTTCGGAAGCTGTACGAGCTTCTGAAAGGCTTGCTAAAAGCTCGTCTAGTGGCGTTTTCGGACAGCCCATGGGCGTCGCCCATCGTGATC
GTGCTCAAGAAGAATGGAGTTGATATTCGGTTGTGCATCGACTACAAGCTGGTGAATGCAGTTACGGCGATTATGGAGTACGCCATGCCGTTAGTCGACG
ACTTGTTGACCGACCTGGAAGCCTACTTATGGTTTGCTCGCTTGATGCGGCCAGTGGATTCTGGGCTATTATGATGACGATGCGAGCCCGCAAGGTCTCG
GCATTCGTCTGTGCACTCGGACATTTCGAATGGCTTCGTATGCCGTTTGGATTGAAGAATGCACCGATGATTTACCAACGAATGATTGACAATGCTCTGT
GGGGTTTCGTTCAACCCAAAGGCGGCTGGCTCCACTTTTCGGAGCTTATGCGAACGGCCGAAGCCCACGCCGAGGTTGCGCGGACAGGGGTGACCGACCC
TTCATCGCGACGACTCGAGGTGTCAACAACTCGGGTGACCAAATTCGAGGCCGACCGCGAATCCTCGGTCACGCTTGACGCAGTGAATGGGTTAGTGAAC
AGCCCTGTTGCCGACATGTTCTCCACCGGAGAACCGGATGAATCCTCGTTGGTGCCAGTGTTCGACCGACGGTCGTTTGTCGATGATATCTGTTTCGGGT
CCGAGACTTTCGACGCGTGCCTGGAGACGCTCGACCGACTGCTCCAACGGTTCACCGAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCA
GCCAAAGGTGGATTTCCTGTCACACGAAGTCTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCATTCCCTGCTTCG
AAAAAAGGGATGCAGTCTTTTCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGTATGGAGCAGCTTTGTACCAGTTGAAGGACG
AAGACTTCACGCCTAGTGGCAGCCTCTCGGCAGCCAAACGAAGCTTCGCCGCGCTCCAACAGAAGGTTGCAGAGGCACCGATCCTCCGGCACTTTGACCG
GGACAAGGAGGTGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCATGATGACAAGCTGCACCCGGTTCGATTTTGT
GGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCATTACTGCTGGTGTTGAAAGTGTGCTACTCCCAGTTGGTGG
GTCGGACCATCCGCGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCCAAGACACTGTTCGGTCGAGCGACCCACTTTGCGGTTATGTTGTC
CCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGCCTCACAAGCTTCGTGGAGTTGGAAGACTCG
TTGGCCCCAGTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCGAGGTCCTATACCGGATTGGTGA
TGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGGATATGGCAGTTGCTCGTGGATTTTGTGGAAATTACCAGAATGGACTGTAGTGACGGCTGC
GAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGAACATGGAGCCGAGGATTTAGTC
ATCGTGGGGGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTTCAACTGAATCGTCACCGAGAACTCA
CGACCAAGCTGCGGTCGGTGAAGTACCTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCAAGCGAGGCTCTCAGCAGCAAAGAATCCAG
CGTAGCTTCGACCGAAGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTACGAACCCTCAGTACAGACCACGGCCGAAGAGAAA
CCGACAGTCAGCCTCGCCCGAGCCCAAGTAGCCCGTGGGATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCGACTACCTAACTGCAA
CAACCAGACACCAAGCAAAAGCGAGGATGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGAATGGTATAGCTGAGCAAGACGAAGCGAA
TGGTGTGACCACCGAAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGTAGACCCTGGCGCTCCAAACGCAGACGACGTTGACCCTGTGGTT
ATACAGGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCAAGGAAACAGACCTAA
GCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGGTGGTGTACTGTATTTTCTTGGAACGAACCGTCGGTGGGGCAA
CGAACGCCGAGAGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTATTACGGAGTTGCCACGACTCGTTGGAAGGTGGCCACCAA
GGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGTCAAGTCCTGCTCCGACTGTAGTT
CGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGATGGATTTCGTCATACCGTTACC
GAAGTCTCGTCGAGGCAACTCAGCCCTACTACTGTTCCAGTGCGCATTCACAGGATTCGTCATGGGTAAAGCTATGTCAGACACTACCGCTCTGAAAGTC
GCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCTCGCTTCATGAGCGAGGTGTTCCAGACCT
TTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGGTGAAGACGGTCATGCAATCGGT
ACGGGTGTACGCAGAAGACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATCAACAACTCTCAAGATGGCA