Description :
From Genome Similarity Track
Location :
Scaffold_3597:5- 1524
Transcript NameFunction/comments
Phypl_g15927hypothetical protein

Sequence
1519 bases(100 bases per row)
CGCGTCCTCGATCACCCGCCTTCCAGGTCTCTCCTGGAAGCATTTCCTGCGTGACCTCAAGGCTGGCGACATCGAGCAGGTCTGCTTGATCACTGACGCA
GATGCGACTGTCCACGCGGTCAACGCAGTCTCCGACGGcgactcgccgtcgcgtctCAGGAGCGCTGAGCCGAAATCGGCCCGCGAAGAACGCTTCGTGG
CGCAGTCGTGGAAGGCCCTGCGTCAGTCTGGAAACACTGTCTACGACACCGCCCGCGAGTACGCAGACGTCTTCCCGGGCAAGATCCCCGCAGAGCTTCT
CGCCGACCGAGGTGTTCGACACGAGATCAATCTCGCGCCTGGTACGAAGTACTGTATGACTCGGCAGTGACCACTGCCACGAGACAAAGTCAAGGTCGTA
GATGGTTTCTTCGAGGGTCGCCCCAAGGCGGGCCACGTACGCGAAAGTATCTCGCCGGACCCGAGTCCGACCTTCCGTGTGAAGATGGCCGCCGGTGGTT
GACGAATCGACGACGCGTTCAACAAGCTGAACGACGCCACCATCCCCGCGCAGACGCCGATTCCTCGGAAAGACATGGTGCTGAACTCCATGTCGGACAG
CGTCATCTACAGCGCTTTCGACTTGACCGACGGCTTCTACCAGATCCTCATGAGAGCGTGCGACATACCTCTCACGGCAGTAAGCACTTCGAGTGGCATG
CTCTGGGAGTGGGTGGTGATGTCGCAAGGCTTGAAAAACGCTCCTGCTACCTTCAATTACATGATCTCCCATGTGCTTAGCCCGCGTCGCGAGTTCGCGC
CTAGATACTTCGACGATATATTCGTGCACAGCCGCGCTGAGAGCTAGTTCAGCGCAGTTGAAGTCACATGAGGCAAGTCTTTCAAGTGATGAGGGATAAC
TGGTTGTACGCGAACCTGAAGAAGTGTGTATTCTGCGCACCGGAGATTCCGGTGTTGGGCTGTTACGTCAGCAAGGATGGAGTACGCGCTGATCCTGAAA
ATATATCGTCTATTTGTTGATGGCCAGCCCCTAAGAGCCCGACTGAGTTGCGTCAGTGGCTGGGCTTGGCTAACTACCTGCACAAGTACACGAAAGATTA
CGCCGGATAGACCCAGCCGCTGTCGTCCCTGCTAAAGAAAGACGTCGCGTGTTCGTGGCATCCTGAACACCAAGCAGCATTCGACTCGGTGATGAGGTGT
CTGGCGGCGGGGCCGATACGGGTGCTTCCAGACGACTCGAAGCCATTCCACGTCGTCTGTGACGCCAGCGAATTTGCAATCGGCTGCGCGCTTAtgcagt
tcgacgacgagggtcACGAACGGGTCGTGAGCTACCACTCACGACAGCTGAAGCCCGTAGAGCGTAACTACCCGGTCCACGACAAGGAACTCGTTGCGAT
GCTCTACGCTCTGGTCAAGTTCATAGTGCATGTCCTCGGTGAGCAGACATTTGCCGTGTACACTGATCACGCATCGCTGCGCACAGCGATGAAGGGCCCC
CACTTGTCGCAACGGCCGG