Description :
From Genome Similarity Track
Location :
Scaffold_172:5- 1522
Sequence
1517 bases(100 bases per row)
CACTAGAGCTCCTTCACCTCCGAAATTCAGATGCAAAACCTACCTAGTACAGCCATGCTATAGACGCTTGCGGTTTGCGTTGGTAGTTCCTTATAGACAC
AATAGCGAAGTTGTCGAGTACAGTTGCTCTATATGCTATTATTAGTTGACCGTGTTCGCTACGAGCGTGTCGTAATAAACTACTGTGCTTGGAAGCTCGA
TCCTGGGTCTGTATGACCCGACCTCGGCCGAAATACCGCGGCAACCAAAACGTGTGTCAGTACGTGTATGATGAGACATGACGCGACGTGACGCCCACGA
CCACTACACCTATTGACAAACGTTTTCCCAACGCATACACCTTTTGACGTTTCCCATAAAAATGAGCAAAAGTGTAATCGGTGTGGCCCACAACATAATA
TACAAACTTATATATTTGTTTTTAGAGTCCATCCTTCTAGGGTACCATGGTTTTGGTACAGGTCGGATAGGTCCTATAGTCGGATATTTCATGGTATGGA
ACGCAAAATCAAGGCGCCAAATGCAGAGATTCACAGCTGCTGTATAGTAGCTGTTTCTTTTTTTTAAGTTGGGAGGTAAACGACCACAACACGCGGAGTG
GCTGGGGCCAGGACCACTAAATTGAGAAAGACGTCTAAGGGCGTGATCATCGTTTTACTTTTTGTGCGGACCACCCCTTAATGTCACTATCCATACACTC
GACTATAGCTGCAAGCATGCGTAAATAGTTATGGGGTGCCGGCGACATAGCCAGCGACAGCTTTTCCGACTCCTCGCCTCTAACAGCATTTTACATGTTA
GCATGTGAAACAATTGGCGGGAACCCGGGTTCCCGCAAATGATACATGTACCGACCAAATCGCGAATTATTTATTTAATTTTTGGCCTCCATATTGGTAC
CCTCGGGGCAAGTTAAACCCTCATACCTAAGTGCTGTCGATGAAGGACCACCCTCAAAATATACCACCGGTACTGAATAGACCCCAATAACATACCTTAT
CATGTCCAAGTTAATCTTTCATGAGCAGGAGGATAGCGATGAGACCGGGAAGCACTGTACCGCTGCACCAGGCGAGCGTCTGGATTTTCGTGGAGAGACA
CAGGACGAGGGCGAAGGTGAATTAACCTTCCGTTCCCCTACTGAGCTTTAGCTGCGTTCTATGTAGGTCATAGACCAACACTTCAATACATTTGCTCATA
CATGTGTACCATTTAATTCTAGGCCTCCACCCATTTATGCACCTCGATTTATCGTAAATCTAGCAGGTGGTCGTTATAAATACAGCAAATTTCGCCCCAT
ATTGCCAAAATCATTGCAAAGCACAATAAATACAGTCCAATGTAGACCCCACGAGCTATTTGATATTGGTACCATAGGTTGTCCTCTTTTCAGAGACAAT
CAGCTGATTCTTCGGCCTCCTGACTCATAGCATCATTGGAAACTTCAAAATTGGAGTGGTTTACAATAAAATGCTTGTGTTAGCATAACCGTACTGTTTT
ACATACCGCAAGCTCTA