Description :
From Genome Similarity Track
Location :
Scaffold_59:5- 1495
Sequence
1490 bases(100 bases per row)
AAGTGTGGCTATATTTAGATTGTCTTAAAGATGGGTACGAGCTAAAGCTGACTCGTATGTGGCATGGGCCATTCCGGGTGGATGAAAGATGCGGCGATAA
TGTAGTAAGGTTGGCAGCCGCTGGCACAACCTATCGGTTGTTCCCGGTGGTTCATGTTTCTAAGCTGAAGCTCGTGAAGGTACTTCCAGAGCGGCTCCTG
AATTGGTTAAACGTGGGTGAGTCCCATCGAGTCGATTTAGATGAAGCTTTACTAACCAAAATTAGCTGGGAGGCGATTCAGAACAGAAAGATTTTGAAGT
GGAGAAAACTGAAGATGTGCTATGAGGTCGGAAAAAGCGCTACGGGCGAGTGCGCCGTCAATTTCTGGTTCATTGGAAAGGTCATAGCGATCCGTCATGG
GTGGTTGAAGCAGACTTAAATTTCAGCTCTTTATTACAAGAGTTCGATAGCGATCGATTAAGCCGGAATCAATTTAAAGTGGTGAAATGAAGAAGGGCCA
GCGACCTAGACCAGGACGGGGTGACCAGAGTGTGTAAATATGCAAGGAGGCTGTATGTGGTTGTATCTTGTGAAAAAAACGCACCGGGAGGTGGTGTGTG
AAGACGAAAGGGCTGTTTGTTAATGTATATGGCGATCGGGGTACGTCGCGTCCAAAGGTCCTGATAAAAGAAGGCATTTACAAGATCAAGGACAGCAATG
GAATTGAAACTTGAAAAATGTATTGAATTAAACGGACTACGGAACGACAAACTTACCATTCAGGCTAGAAAACGACATGCCTGGATGATATGCGATAGAT
GTCCGGTACTGATTGTGCCACGGCTTGGCATAGTTAGTCAAAGAAAGTGCGGAAGCCAATTTGGGGATACTAGTTTGCCGAGTCCCCAACCCAGGATACC
GACACTGCTTCCCCGTCGACGAGGCATGTGCAAGTATACCGGGTCCAGTATAATGTCAATGTTACATCGTCCTTCTATCGTACCCTGGAATATAAATCGG
AGAGCTTTTTTAGCGGTGCCCATATCGCGACCGCCGCTGCTTCCGCTGATCGCAATGTTAAGCCAACCCCCAGATCAGAACCCGATCCGCTGAGGAGATT
GGTTAAGTGTGGGTCGATTCGCACAAGGTCTGGATATAGCGATACCGAAGTTGCGGTACATATTAGGCAACTACTTGAACCATACGATGGGCAGGAAAAA
CACGCACACGATCCTCGTCTTCAGAATCGTCCAAGGATATTGACGGGAAAGTGTAGCGATCTGTGCAGAGAGTTTCAGACGGGAGGACCACTCAGATACT
GGAGGCGGTCGCGACACACTGGGAAGACCCCAGAAGGGATAATGCTCAATGCTTGCGAGATGGAGGCAGAAGAACATCAAATTCGGCTCCGATACGCTTA
TCCATCTCATTCTGCGGGCGGAACAATCTGAGACTGGAAAAAATGATTTTGGGACACGATTGCGATATCCGGGTATCCACTGATCACGGG