Description :
From Genome Similarity Track
Location :
Scaffold_2270:5- 1463
Sequence
1458 bases(100 bases per row)
GCTTTGGCCAGCACTGTATTGTTCACACACTTGAGGTATAACTTGTTGAACCCATTTTAAAAGCATTTTCTTTATAACATGGAAGCATTTAATTCATTTA
GCCAGGGTTTCCCTTCTTTTTCATCCACGATGCCCGCATGCTCAGACTCCCACAAGCACACAGAGCTCAAGCAGGCAAGACGCACACACGACCGAGCGCA
CTCCTGAAGAGCAGAGTGCGACGCGGCGCGGTTTCAATCGCTCTGCTTTCTCGCTGGCACCGATATCGCTCGCGGCCGTGGGTGTGGTGCTGGGGCTCAT
GCCGATCGCAGGCGTGCTCTTGCTCCTCGTGTGCAGCTACGTCACGCGAGATCAAAGGCAATCTGGGCATGCAGATACCGCTGCTCGAGTGCGTTGCTGT
ATACTTTCTCTATACACATCTCTTTCTCTCTCTCTTTCTCTCTTTCTCTCTTTCTCTCTCTATCTATCCATGTATCTCGCTGTGCGTGGCCAGGCGATTT
ACATTGTGTGGCTTGTTTGCTGCATTGTCTTCTTCATACAATGGATTCACCTGAACGCACAGTGGCGAGTCGGTCGGATACCGCGTGAACGCCGCGACAC
GGTACGAATGAGCTGCTTTTCCCAGGTCTCCTATCCGGCGTTTTTGTACAAGTAGGTATAAACTAACGCATCGCATGCTCGTTGTGTGTCTATCTACTTT
ACAGAGAAGCCGAGGCTGGGTTTACTCTCTGTCCGGGGTGCGAGTTCAAGAATTTCAAGCGCTACACCTACTGCAGCCTCTGCGGCGAGAAGCTACCTGA
GCCAGTGAATGATAGGCCGCCTATGTCCGTTCACGCTCAAGGCAGTGTCGTACTACTCGACACAGTACATCTCGAGTCACGCATGCTTCAACCGTTTGGA
TGTGCCGCTGTATCGCTCGAAGGACGAGCTGAGAACGATGCTGCTGGCGATTCTCGACACGGACTTGTACGGATTCACAACTGCGTAGTTTTGGGAACGG
ATATGGCAAGAATTTGTTGAAATCCAATTCATGTGAAGTATATACAAAAAAGTGCAAAGTTTGGTTGAGGGAACTCCAAAGTGTAAGTGGGTGGGTCCGA
ACGCAGTGCTTCCATTCTTCATATTCGATATCACGGTGAACATCACTGTCACAGCACCATTTTAGAGAGAATTGGTTCGTTCTACGCTAGACGGTTCTAG
GTATACCCACAATAAACCCATTATACGAAGGACTGCATGCAAGAGAAAACTTTTTGTCTCTTTTGGAGGATGGCCTCACCGCGAGGTGGACGTTTTCATC
ACCTTCACTGCTGGGAGCGAAAGCGAGGAATACTTCCATTTGCCATTTACATCCTCCGACAGAACCAGTCAGCCAGCGCGCCACAGCCTCACCCTTGACG
AATGGGTGTTGCCAATAGCACTCTGCTCGAGGGTGTCGTTCTACTGGCTTTGTGTCTA