Description :
From Genome Similarity Track
Location :
Scaffold_444:5- 1459
Transcript NameFunction/comments
Phyra_86066pol protein

Sequence
1454 bases(100 bases per row)
CACCCGCGCCGGGTCCCGGTACGGCTTGAGCAAGCCCACATAAAACACCGGATGGGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTC
TTGGCCACGACTTTGAAAGGTCCGATGAAGCGTGGGCGCAGCTTCGTCTTGAATACCGCAGAAACTGCATGTGTAGGTAGGTTTTTTGCGTTTAATAAAA
CCAAGTCTCCGACTGCGTAACTTTCAATGTTACCTCTGCCCCTGGCATCTGCGTTTTCCTTTTGTTGGTCTTGGCTCTCAGCCATAGCGTCACGTACGTG
TCGAAGGACACTCAGACGCGTTGACAGAAACTCGTCAACCTGTTTACGAACAGCGAGAGGGCTGACATCAGCAAGCCGACCGGCTATCTCTCCCCCACCA
AGCCCGGAACCACGGAGTGGTAGCGTCAACGGGACGCGAGGGTGGGTGAGGCCATTCACGTAGAATGGGGTAAAGCCTGTGGAGGCATGAACAGCATTAT
TCAATGCGAACTCCACGAGTGGAAGCATGGTGCTCCAACGCTTGGGCGTTTCGGCGCAAACGCTGCGGAGGACGTCCTCCACGACGCGATTAACGCGCTC
GGTCTGACCATCGGTCTGTGGATGATCCGTTGTGGACATGTCCAATCGGGTGCCCAGCACCTTGAAGACGGACGACCAGAACTTACCCGTGAAACGGGGG
TCTCTATCCGAGACGATCGACTCGGGCAGCCCGTGCTGGCGGAAAACCCGGTCGATAAACAGCTTGGCTGTACCTTTACCATCAATGATGTCCGGCACCG
CCGCTAGATGAGCCATCTTGCTCAAACGGTCGACAAAGACCACGATGCCCGTGTTGCCATCCGAGTCCTTCGGAAGGCCGAACACAAAGTCCAAACTCAT
GGACTCCCAACACCCAGAGGGTACAGGCATGCTTGCCAGCGGCGCGGCCGCATGCGGTGAGGGCTTCACCCGCTGACACGTCTCACACGTGCGCACATAC
GTGCTCGTCCACTTGTAAAGCTTGGGCCACCAATAGGAGAGGCTCACAGAGCCATAGGTCTTTTCACGACCAAGGTGGCCACTAAGCGCAGTGTCGTGTG
CCTCATAGAGGATACGATATTTCAGATCCTCATCGTGAGGGACCACAATACGTGGAGTATCCTCCGGATCGGTGCTGTAATACAGCAGGCCATCATCGAG
CGAATATCGATGCAGCCTCGCGCGTAAGCGCGCCGACAGCTTACAGTCCGAGTCTCCAAACTCCTTGCTCCCAAGAGCACGTAGCAGAGCGACACACATG
TCGTCACGCGCATACGCAGCGCGGATCAAGTCCGTCCCGGACGACGTCACAGTCGTGACATGAGATAACTCATAGTCGGGTCTGCGGGACAGCGCGTCCG
CTAACCCGTTCTGCCTGCCAGGCTTGTACTTCACCTCGAAGTTGTACTCCGCAA