Description :
From Genome Similarity Track
Location :
Scaffold_4216:5- 1383
Sequence
1378 bases(100 bases per row)
AGTCGATGTAGATATTCCAACGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATCCACAGTACTGGGTCTGGA
AACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGAATCTGTCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAAGTCAGACA
CTTCTCGGCATCTGACGCTTGATCTCTCGTGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGATCCTCGTCATGATCCTTGCCCGTGAACTCC
TTCAGATCCGATATGGCTGAGCTCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGC
CATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGATTCCATCTCCACGTCTCGTGCTCCATGTTCATGGAGCACTTGCACTTG
TGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCAGAAGAGCCTGTG
GCCGTCTGGCCCGCTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAGTCCCACTGGCTTCTTGCCGGATCTAGCTCGATCCT
GGCTGGATTGTATCAGATCACGGGCGGGGCGTACTGGATCCCGAGCCTTCACGTTCACAGGGACTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCAT
GGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGGCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTG
ATCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCA
GGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGC
CGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCGTCGATCTGTCGGGGATTCAGGAATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGC
TTGGGGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGGCTTTCTTTCGAATCGTGGAGGTTGAATCCTTCTTCGGG
CGAAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTAGTGTTTGAGGAGCAGGGGTGGCTTAA