Description :
From Genome Similarity Track
Location :
contig_39:5- 1285
Transcript NameFunction/comments
g6884.t1hypothetical protein

Sequence
1280 bases(100 bases per row)
TACCCCCCTCCCCAGGCCCCTACTGGGGCCCCCGCGGATCACGATGCGAATCGTGATCCGCCGGATGAAGGTCCGACGGTGAAAACCGAAGGACTTTCAT
CCACAACTACTCCTCCAACCTCTCGATCGGCACCGAAGAAGAAGTCGAAGACATCGCGCATGAAGATGAAAGCGCCAGAATCGGATGCTGAGGACCAGAC
GGACAATGAAGGCTGGACAGAAGAGCAGTTGGAATCTGTTTTTCTATCGAAAAGACCTGTACAAGTTCCTGACCGAAGATCGAACGATGAAGATCATGCA
GCTGAAGCTGATCGGCGATCTCCAAGGTCCGGTGAAGGCACCCAGAGAAGTGTCGAACAAGTTGGACGCAGTCAGAGCCCTGATGCGAATGCTCAAGGAG
GCTGGAATAGTTCTTGGTGCGTTCGATGCAAACGAATTGTTTGATCTAGAACTGGAAACGATCAGAGAGGCAACTCTAACTCTCTTCGCCAAACTGACGC
ATATGGTGGGCAGCGTAGTCCCGATCCAGCAAGCAAGATTGCCTACGGTCCGCAGCCAGACGGGATCTTCCCAATACGCGTCTGCCACGTCAGAGGCGGG
GTCAGATAGCTCGGTTGAACTGCAACGAATGACACTCGGGCCAGTTGGAGTAGCCATGTTACGATCACACAAAGATAGATCGGAAGTCAAGACATCAGCT
GACCCAAGATCTGGCCAAGCCCAAGCAACACCCGATCGCATGCAAACCTTTTTCAATGCAGCGATGGAGCGTTTTCTGAAGGGGCAACAGACGCCGGCAG
TCCCGCAGACGGCCGATCGCCCTGTTACCTATCGGACCAAATCGCCCGGAGCTCAAGACGTCGAGATGGAATCAGTGGAATCAAACCACGTGGTCCACTC
TCATCCAAGCGAATACGATCCGGATGATCTGAGCGTAGGAACTCCCAGGTCGCGTCCGCCGAAAATTCTGGTGGCGGATCGCTCTCTGCTACTCGAATCA
AAGTGTCGGCGATCTCTGAACTAAAGGAGTTTTCCGGAAAGGACAATGACGAGGACCGCGCCAGGGGTTGGCTTAGCAAGATGAAGTCTGCTTTCATCCG
CGACCAAGCACCCGATAGCGAAAAATGTTTGGTGTTCGGCGATCTGCTCAAGGGACCAGCGCGTAACTGGTACCGACAGCTAAGCAGGACTACACGGAGT
GACTGGAAGAGTTTATCTCAAACGTTCCAGACGCAATACTGTGGCAGGGGAGTATCTGTCGCGAGACAATACTACCATGC