Description :
From Genome Similarity Track
Location :
Scaffold_3279:5- 1259
Sequence
1254 bases(100 bases per row)
CTGGTTCCTGGAACCAAATACTGCGTGGCAAGGTGGTGGCCTTTGCCACGGGAGCAATGTGACGTCATTGACGCGTTCTGCGGTGCCAAGCACGAGGCGG
GCATGGTGCGCGAGAGCAAGTCTCCGCACTCAACGCCTACGTTCTGTGTCAGAAAGCCGAATGGCAAGTGGCGTATCGTGCATGCTTTCAACAAGCTTAA
CGCGGCCACCATTCTGGCGCAGACGCCTATTCCTAGGAAGGACGTTCTCCAGAACAATATGACGGGGTGTGCGGTGTACACTGCCCTCGACTTGGTCGAT
GGATACTATAAATGGCTCGTGAGAGCAAGCGATATTCCGCTCACAGCGGTCAGCACTCCGAGCAGTATGCTTTGAGAGTGGCTGGTAATGCCCCAAGGGC
TGTCGAACGCGCCAACTACGTTCAATCGTCTAGTGGCGCAGCTGTTCAGGCCCCACAGGGCGTATGCTCAGACATACTTCGACGACATATTCGTCCACAG
TCGTGCTGAGCACGGAAAGACTGATGTGGAGAGCCACATTGAGCACCTGTACTCGAGTGCATGCGCACACACAATTTGTATGCCAACATCAACGAGTGTG
TATTCGGCGCTGAAGATATCTCCTTTGAGGGATGCTTCATTGGAAAGCGAGACCTTCGAGCGGACCCCGCTAATGACAAGACCATTGTAGACTGGCCGAT
TCCAAAGAACCAGAAGGACTTACGGAAGTGGCTTGGCTTGGCCAATTACTTGCACAAGTACGGCAAGAATTATGCTGAGGTGGCAAGGCCACTGTCCAAT
CTCCTNATGTGGACTGGTGTTGGGACACCGGACATCAAGCGGCTTTTGAAGCCATTAAGGAGAGCCTCCTTCAGGCACCGATCCTGGCGCTGCCAGATCC
CGATCGTCCTTTCAGTGTCGTCTGTGACGCGTCGGACTTTGCCATCGGCAGTGCTTTGTTGTAAGCAGACGCTGAAGGGCGCGAACGAGTGGTGGCGTTT
GAATCTCGTCAGTTTTAGGCTGCTGAGAAGAACTATCCAGTTCAGGACAAATACCTACTTGCAATGAAGTATGCTCTCGTTAAATTCAGGGTTCATCTGT
TAGTCTCCAAACCGTTTGTGATCTATACAGATCATGCGTCGCTACGCACTGCTACGCAGTCGCCTCATCTCTCTCAGAGAATGGTCTGTTGGCTCTCCTT
CTTTGCGGAGTACAACTTCGAGGCGAAGTACAAGCCTGGCAGGCAGAACATTCT